AIPL1 (NM_001285403) Human Untagged Clone

CAT#: SC334906

AIPL1 (untagged) - Human aryl hydrocarbon receptor interacting protein-like 1 (AIPL1), transcript variant 8



  "NM_001285403" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
AIPL1 mouse monoclonal antibody, clone OTI3B4 (formerly 3B4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIPL2; LCA4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001285403, the custom clone sequence may differ by one or more nucleotides


ATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAACCATTCTGCACGGGGGCACGGGCGAGC
TCCCAAACTTCATCACCGGATCCCGAGTGATCTTTCATTTCCGCACCATGAAATGTGATGAGGAGCGGAC
AGTCATTGACGACAGTCGGCAGGTGGGCCAGCCCATGCACATCATCATCGGAAACATGTTCAAGCTCGAG
GTCTGGGAGATCCTGCTTACCTCCATGCGGGTGCACGAGGTGGCCGAGTTCTGGTGCGACACCATCCACA
CGGGGGTCTACCCCATCCTATCCCGGAGCCTGAGGCAGATGGCCCAGGGCAAGGACCCCACAGAGTGGCA
CGTGCACACGTGCGGGCTGGCCAACATGTTCGCCTACCACACGCTGGGCTACGAGGACCTGGACGAGCTG
CAGAAGGAGCCTCAGCCTCTGGTCTTTGTGATCGAGCTGCTGCAGAGGGAGACCTGGAACCTGAGCAATC
ATGAGAAGATGAAGGCGGTGCCCGTCCTCCACGGAGAGGGAAATCGGCTCTTCAAGCTGGGCCGCTACGA
GGAGGCCTCTTCCAAGTACCAGGAGGCCATCATCTGCCTAAGGAACCTGCAGACCAAGGAGAAGCCATGG
GAGGTGCAGTGGCTGAAGCTGGAGAAGATGATCAATACTCTGATCCTCAACTACTGCCAGTGCCTGCTGA
AGAAGGAGGAGTACTATGAGGTGCTGGAGCACACCAGTGATATTCTCCGGCACCACCCAGGTGCGCGGGG
CTGCAGGGGCGGACAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001285403
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285403.2, NP_001272332.1
RefSeq Size 1418 bp
RefSeq ORF 789 bp
Locus ID 23746
UniProt ID Q9NZN9
Protein Families Druggable Genome
Gene Summary Leber congenital amaurosis (LCA) is the most severe inherited retinopathy with the earliest age of onset and accounts for at least 5% of all inherited retinal diseases. Affected individuals are diagnosed at birth or in the first few months of life with nystagmus, severely impaired vision or blindness and an abnormal or flat electroretinogram. The photoreceptor/pineal-expressed gene, AIPL1, encoding aryl-hydrocarbon interacting protein-like 1, is located within the LCA4 candidate region. The encoded protein contains three tetratricopeptide motifs, consistent with chaperone or nuclear transport activity. Mutations in this gene may cause approximately 20% of recessive LCA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (8) uses an alternate splice site in the 5' coding region and represents an alternate 3' UTR, compared to variant 1. The resulting protein (isoform 8) is shorter, compared to variant 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...