PABPN1L (NM_001294328) Human Untagged Clone
CAT#: SC334873
PABPN1L (untagged) - Human poly(A) binding protein, nuclear 1-like (cytoplasmic) (PABPN1L), transcript variant 2
CNY 2,640.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ePABP2; PABPNL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001294328, the custom clone sequence may differ by one or more nucleotides
ATGTGGCCCTTCCCGAGCCGCTCTCTCTTCCCACCCCCGACTCAGGCCTGGCTCCAGACGGTCTCCTCAG ACCCTGAGGCCCAGGGCTGGGGGGCCTGGAACGAGACCAAGGAGATTCTGGGGCCAGAGGGTGGGGAAGG GAAGGAGGAGAAAGAGGAGGAAGAGGATGCAGAGGAAGACCAGGATGGGGATGCAGGCTTTCTGCTGTCT CTGCTGGAGCAAGAGAACCTGGCTGAGTGCCCATTGCCTGACCAGGAGCTGGAGGCCATCAAGATGAAGG TGTGTGCCATGGAGCAGGCCGAGGGGACGCCACGGCCTCCAGGAGTGCAGCAACAGGCCGAGGAAGAGGA GGGCACCGCGGCCGGGCAGCTGCTGAGCCCTGAGACCGTGGGCTGCCCCCTCTCTGGGACCCCCGAGGAG AAGGTGGAGGCTGACCACAGATCCGTCTACGTGGGCAACGTGGACTACGGGGGCTCCGCCGAGGAGCTGG AGGCCCACTTCAGCCGCTGTGGGGAGGTCCACCGAGTCACGATCCTGTGTGACAAGTTCTCTGGACACCC CAAGGGGTGCTGCCGAAAAGAACCAACTTCCCTGGGATCAGCTCCACAGACCGCGGGGGCCTTCGAGGAC ACCCAGGCTCCAGGGGGGCACCCTTCCCCCACAGCGGCCTCCAGGGCAGGCCCCGGCTCAGACCACAAGG GCAGAACCGGGCCCGTGGAAAATTCTCACCATGGTTTTCACCGTATTAAAGGGAAGACCCGATTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001294328 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001294328.1, NP_001281257.1 |
RefSeq Size | 1221 bp |
RefSeq ORF | 768 bp |
Locus ID | 390748 |
UniProt ID | A6NDY0 |
Gene Summary | Binds the poly(A) tail of mRNA.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate exon, which results in a frameshift, compared to variant 1. The resulting protein (isoform 2) has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236979 | PABPN1L (myc-DDK-tagged) - Human poly(A) binding protein, nuclear 1-like (cytoplasmic) (PABPN1L), transcript variant 2 |
CNY 3,990.00 |
|
RG236979 | PABPN1L (tGFP-tagged) - Human poly(A) binding protein, nuclear 1-like (cytoplasmic) (PABPN1L), transcript variant 2 |
CNY 4,370.00 |
其它PABPN1L产品