n-Myc (MYCN) (NM_001293231) Human Untagged Clone
CAT#: SC334854
MYCN (untagged) - Human v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN), transcript variant 3
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHe37; MODED; N-myc; NMYC; ODED |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001293231, the custom clone sequence may differ by one or more nucleotides
ATGCGGGGGGCTCCTGGGAACTGTGTTGGAGCCGAGCAAGCGCTAGCCAGGCGCAAGCGCGCACAGACTG TAGCCATCCGAGGACACCCCCGCCCCCCCGGCCCACCCGGAGACACCCGCGCAGAATCGCCTCCGGATCC CCTGCAGTCGGCGGGAGATGATGAAGATGATGAAGAGGAAGATGAAGAGGAAGAAATCGACGTGGTCACT GTGGAGAAGCGGCGTTCCTCCTCCAACACCAAGGCTGTCACCACATTCACCATCACTGTGCGTCCCAAGA ACGCAGCCCTGGGTCCCGGGAGGGCTCAGTCCAGCGAGCTGATCCTCAAACGATGCCTTCCCATCCACCA GCAGCACAACTATGCCGCCCCCTCTCCCTACGTGGAGAGTGAGGATGCACCCCCACAGAAGAAGATAAAG AGCGAGGCGTCCCCACGTCCGCTCAAGAGTGTCATCCCCCCAAAGGCTAAGAGCTTGAGCCCCCGAAACT CTGACTCGGAGGACAGTGAGCGTCGCAGAAACCACAACATCCTGGAGCGCCAGCGCCGCAACGACCTTCG GTCCAGCTTTCTCACGCTCAGGGACCACGTGCCGGAGTTGGTAAAGAATGAGAAGGCCGCCAAGGTGGTC ATTTTGAAAAAGGCCACTGAGTATGTCCACTCCCTCCAGGCCGAGGAGCACCAGCTTTTGCTGGAAAAGG AAAAATTGCAGGCAAGACAGCAGCAGTTGCTAAAGAAAATTGAACACGCTCGGACTTGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001293231 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001293231.1, NP_001280160.1 |
RefSeq Size | 1829 bp |
RefSeq ORF | 762 bp |
Locus ID | 4613 |
UniProt ID | P04198 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene is a member of the MYC family and encodes a protein with a basic helix-loop-helix (bHLH) domain. This protein is located in the nucleus and must dimerize with another bHLH protein in order to bind DNA. Amplification of this gene is associated with a variety of tumors, most notably neuroblastomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (3) lacks segment 1b and exon 2, which results in an upstream AUG start codon, compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236960 | MYCN (myc-DDK-tagged) - Human v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN), transcript variant 3 |
CNY 3,990.00 |
|
RG236960 | MYCN (tGFP-tagged) - Human v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN), transcript variant 3 |
CNY 4,370.00 |