RFC2 (NM_001278791) Human Untagged Clone
CAT#: SC334851
RFC2 (untagged) - Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
RFC2 mouse monoclonal antibody, clone OTI3A7 (formerly 3A7)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RFC40 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278791, the custom clone sequence may differ by one or more nucleotides
ATGTTGGAACTCAATGCTTCAAATGACAGGGGCATTGACGTTGTGAGGAATAAAATTAAAATGTTTGCTC AACAAAAAGTCACTCTTCCCAAAGGCCGACATAAGATCATCATTCTGGATGAAGCAGACAGCATGACCGA CGGAGCCCAGCAAGCCTTGAGGAGAACCATGGAAATCTACTCTAAAACCACTCGCTTCGCCCTTGCTTGT AATGCTTCGGATAAGATCATCGAGCCCATTCAGTCCCGCTGTGCAGTCCTCCGGTACACAAAGCTGACCG ACGCCCAGATCCTCACCAGGCTGATGAATGTTATCGAGAAGGAGAGGGTACCCTACACTGATGACGGCCT AGAAGCCATCATCTTCACGGCCCAGGGAGACATGAGGCAGGCGCTGAACAACCTGCAGTCCACCTTCTCA GGATTTGGCTTCATTAACAGTGAGAACGTGTTCAAGGTCTGTGACGAGCCCCACCCACTGCTGGTAAAGG AGATGATCCAGCACTGTGTGAATGCCAACATTGACGAAGCCTACAAGATTCTTGCTCACTTGTGGCATCT GGGCTACTCACCAGAAGATATCATTGGCAACATCTTTCGAGTGTGTAAAACTTTCCAAATGGCAGAATAC CTGAAACTGGAGTTTATCAAGGAAATTGGATACACTCACATGAAAATAGCGGAAGGAGTGAACTCTCTTT TGCAGATGGCAGGCCTCCTGGCAAGGCTGTGTCAGAAGACAATGGCCCCGGTGGCCAGTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278791 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278791.1, NP_001265720.1 |
RefSeq Size | 1861 bp |
RefSeq ORF | 762 bp |
Locus ID | 5982 |
UniProt ID | P35250 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | DNA replication, Mismatch repair, Nucleotide excision repair |
Gene Summary | This gene encodes a member of the activator 1 small subunits family. The elongation of primed DNA templates by DNA polymerase delta and epsilon requires the action of the accessory proteins, proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). Replication factor C, also called activator 1, is a protein complex consisting of five distinct subunits. This gene encodes the 40 kD subunit, which has been shown to be responsible for binding ATP and may help promote cell survival. Disruption of this gene is associated with Williams syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene of this gene has been defined on chromosome 2. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (3) uses an alternate splice site in its 5' UTR, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...