RhoGDI (ARHGDIA) (NM_001301243) Human Untagged Clone
CAT#: SC334812
ARHGDIA (untagged) - Human Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), transcript variant 7
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Anti-ARHGDIA (RhoGDI) mouse monoclonal antibody, clone OTI1A7 (formerly 1A7)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GDIA1; HEL-S-47e; NPHS8; RHOGDI; RHOGDI-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001301243, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAGCAGGAGCCCACAGCCGAGCAGCTGGCCCAGATTGCAGCGGAGAACGAGGAGGATGAGCACT CGGTCAACTACAAGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAG CCTGCGAAAGTACAAGGAGGCCCTGCTGGGCCGCGTGGCCGTTTCCGCAGACCCCAACGTCCCCAACGTC GTGGTGACTGGCCTGACCCTGGTGTGCAGCTCGGCCCCGGGCCCCCTGGAGCTGGACCTGACGGGTGAGT GCCCTGCGGCCGCGGGGGTCCGGGCGGCCCCTGGTGGGGATCTCGGGAAGTGCAGCCAGGGGGCCGCGCA GGGCTGGGGCTTCGCGCAGGGCTGCTGGGCAGTCATTGAGGGGGAGGTCCCCCCAACAGGCGACCTGGAG AGCTTCAAGAAGCAGTCGTTTGTGCTGAAGGAGGGTGTGGAGTACCGGATAAAAATCTCTTTCCGGGTTA ACCGAGAGATAGTGTCCGGCATGAAGTACATCCAGCATACGTACAGGAAAGGCGTCAAGATTGACAAGAC TGACTACATGGTAGGCAGCTATGGGCCCCGGGCCGAGGAGTACGAGTTCCTGACCCCCGTGGAGGAGGCA CCCAAGGGTATGCTGGCCCGGGGCAGCTACAGCATCAAGTCCCGCTTCACAGACGACGACAAGACCGACC ACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGACTGGAAGGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301243 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001301243.1, NP_001288172.1 |
RefSeq Size | 2055 bp |
RefSeq ORF | 750 bp |
Locus ID | 396 |
UniProt ID | P52565 |
Protein Families | Druggable Genome |
Protein Pathways | Neurotrophin signaling pathway |
Gene Summary | This gene encodes a protein that plays a key role in the regulation of signaling through Rho GTPases. The encoded protein inhibits the disassociation of Rho family members from GDP (guanine diphosphate), thereby maintaining these factors in an inactive state. Activity of this protein is important in a variety of cellular processes, and expression of this gene may be altered in tumors. Mutations in this gene have been found in individuals with nephrotic syndrome, type 8. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (7) differs in the 5' UTR and contains an alternate segment in the central coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (e) is longer than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...