TSPAN16 (NM_001282509) Human Untagged Clone

CAT#: SC334786

TSPAN16 (untagged) - Human tetraspanin 16 (TSPAN16), transcript variant 2



  "NM_001282509" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TM-8; TM4-B; TM4SF16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282509, the custom clone sequence may differ by one or more nucleotides


ATGGCTGAAATCCACACTCCGTATTCTTCCTTGAAGAAACTGTTATCTTTACTCAATGGCTTCGTGGCTG
TGTCTGGCATCATCCTAGTTGGCCTGGGCATTGGTGGTAAATGTGGAGGGGCCTCTCTGACGAATGTCCT
CGGGCTGTCCTCCGCATACCTCCTTCACGTTGGCAACCTGTGCCTGGTGATGGGATGCATCACGGTACTG
CTTGGCTGTGCCGGGTGGTATGGAGCGACTAAAGAGAGCAGAGGCACGCTCTTGTTTTGCATCCTGTCAA
TGGTTATTGTCCTCATCATGGAAGTTACAGCTGCCACAGTGGTCCTTCTTTTCTTTCCAATTGTTGGAGA
TGTGGCCTTGGAACACACCTTCGTGACCCTGAGGAAGAATTACAGAGGTTACAACGAGCCAGACGACTAT
TCTACACAGTGGAACTTGGTCATGGAGAAGCTAAAGTGCTGTGGGGTGAATAACTACACAGATTTTTCTG
GCTCTTCCTTCGAAATGACAACGGGCCACACCTACCCCAGGAGTTGCTGTAAATCCATCGGAAGTGTGTC
CTGTGACGGACGCGATGTGTCTCCAAACGTCATCCACCAGAAGGGCTGTTTCCATAAACTCCTAAAAATC
ACCAAGACTCAGAGCTTCACCCTGAGTGGGAGCTCTCTGGGAGCTGCAGTGATACAGTTGCCAGGAATTC
TTGCCACTTTGCTGCTGTTTATCAAGCTGGGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282509
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282509.1, NP_001269438.1
RefSeq Size 1045 bp
RefSeq ORF 735 bp
Locus ID 26526
UniProt ID Q9UKR8
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein might couple to signal transduction pathways and possibly modulate cellular activation and adhesion in haemopoietic and neural tissue. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...