BXDC1 (RPF2) (NM_001289111) Human Untagged Clone

CAT#: SC334771

RPF2 (untagged) - Human ribosome production factor 2 homolog (S. cerevisiae) (RPF2), transcript variant 2



  "NM_001289111" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RPF2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA397G5.4; BXDC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289111, the custom clone sequence may differ by one or more nucleotides


ATGTGGAAAAATATTACAAGACCTTTTGAGGATCAGACATCACTGGAATTCTTTTCAAAGAAGTCAGATT
GTTCTTTATTCATGTTTGGCTCCCATAATAAGAAGCGGCCAAATAATCTAGTAATAGGTCGTATGTATGA
CTACCATGTGCTGGATATGATTGAATTAGGTATTGAGAATTTTGTCTCTCTAAAAGACATTAAGAACAGT
AAATGTCCTGAGGGAACAAAACCCATGCTGATATTTGCTGGCGATGATTTCGATGTAACAGAAGATTATA
GAAGACTAAAAAGTCTTCTTATTGATTTCTTCAGAGGCCCCACAGTATCAAATATCCGCCTGGCTGGATT
AGAGTATGTTCTGCACTTCACTGCACTGAATGGGAAGATTTACTTTCGAAGCTATAAGTTGCTGTTGAAG
AAATCTGGTTGCAGAACACCACGGATTGAATTGGAAGAGATGGGACCCTCATTGGATCTGGTTCTGAGGA
GGACACACCTGGCATCGGATGACCTTTATAAATTATCTATGAAAATGCCAAAAGCTCTCAAGCCAAAGAA
GAAGAAAAATATTTCCCATGATACTTTTGGTACAACTTATGGAAGGATTCATATGCAGAAGCAAGACCTA
AGCAAACTACAAACCAGGAAAATGAAGGGGTTGAAGAAGCGACCTGCAGAAAGGATAACAGAAGACCACG
AGAAAAAGTCAAAAAGAATTAAAAAAAATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001289111
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289111.1, NP_001276040.1
RefSeq Size 3666 bp
RefSeq ORF 732 bp
Locus ID 84154
Gene Summary Involved in ribosomal large subunit assembly. May regulate the localization of the 5S RNP/5S ribonucleoprotein particle to the nucleolus.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate 5' exon and initiates translation at an alternate start codon, compared to variant 1. This results in a protein (isoform 2) that has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...