C6orf89 (NM_001286637) Human Untagged Clone

CAT#: SC334747

C6orf89 (untagged) - Human chromosome 6 open reading frame 89 (C6orf89), transcript variant 4



  "NM_001286637" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BRAP; PS1TP5TP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286637, the custom clone sequence may differ by one or more nucleotides


ATGTCCTTGCCCATTGCCAAGAAGTACATGTCAGAAAATAAGGGAGTTCCTCTGCATGGGGGTGATGAAG
ACAGACCCTTTCCAGACTTTGACCCCTGGTGGACAAACGACTGTGAGCAGAATGAGTCAGAGCCCATTCC
TGCCAACTGCACTGGCTGTGCCCAGAAACACCTGAAGGTGATGCTCCTGGAAGACGCCCCAAGGAAATTT
GAGAGGCTCCATCCACTGGTGATCAAGACGGGAAAGCCCCTGTTGGAGGAAGAGATTCAGCATTTTTTGT
GCCAGTACCCTGAGGCGACAGAAGGCTTCTCTGAAGGGTTTTTCGCCAAGTGGTGGCGCTGCTTTCCTGA
GCGGTGGTTCCCATTTCCTTATCCATGGAGGAGACCTCTGAACAGATCACAAATGTTACGTGAGCTTTTT
CCTGTTTTCACTCACCTGCCATTTCCAAAAGATGCCTCTTTAAACAAGTGCTCCTTTCTTCACCCAGAAC
CTGTTGTGGGGAGTAAGATGCATAAGATGCCTGACCTATTTATCATTGGCAGCGGTGAGGCCATGTTGCA
GCTCATCCCTCCCTTCCAGTGCCGAAGACATTGTCAGTCTGTGGCCATGCCAATAGAGCCAGGGGATATC
GGCTATGTCGACACCACCCACTGGAAGGTCTACGTTATAGCCAGAGGGGTCCAGCCTTTGGTCATCTGCG
ATGGAACCGCTTTCTCAGAACTGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001286637
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286637.1, NP_001273566.1
RefSeq Size 6808 bp
RefSeq ORF 726 bp
Locus ID 221477
UniProt ID Q6UWU4
Protein Families Transmembrane
Gene Summary Exhibits histone deacetylase (HDAC) enhancer properties (PubMed:23460338). May play a role in cell cycle progression and wound repair of bronchial epithelial cells (PubMed:21857995).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) includes an additional exon and uses an alternate splice site in the 5' region, resulting in differences in the 5' UTR and translation initiation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Both variants 3 and 4 encode isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...