Pirh2 (RCHY1) (NM_001278538) Human Untagged Clone

CAT#: SC334726

RCHY1 (untagged) - Human ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase (RCHY1), transcript variant 8



  "NM_001278538" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-RCHY1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARNIP; CHIMP; PIRH2; PRO1996; RNF199; ZCHY; ZNF363
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278538, the custom clone sequence may differ by one or more nucleotides


ATGGCGCCAGCGGTCAAGAGCGAGGCACCTTGCTGTGACAAGCTTTATACTTGCCGCTTGTGTCATGATA
ACAATGAAGATCATCAACTAGATCGCTTTAAAGTGAAGGAAGTGCAGTGCATAAACTGTGAAAAAATTCA
ACATGCCCAACAGACTTGTGAAGAATGTAGCACATTGTTTGGAGAATATTATTGCGATATATGCCATTTG
TTTGACAAAGATAAGAAGCAGTATCACTGTGAAAACTGTGGAATTTGTAGGATTGGTCCAAAGGAAGATT
TTTTCCATTGTTTGAAATGTAACTTATGCCTAGCTATGAATCTTCAAGGAAGACACAAGTGTATTGAAAA
TGTGTCCCGACAGAATTGTCCAATATGTTTGGAGGACATTCACACATCCCGTGTTGTTGCTCATGTCTTG
CCATGTGGACATCTTTTACATAGAACGTGTTATGAAGAAATGTTGAAAGAAGGCTACAGATGTCCATTAT
GTATGCACTCTGCTTTAGATATGACCAGGTATTGGAGACAGCTGGATGATGAAGTAGCACAGACTCCTAT
GCCATCAGAATATCAGAACATGACTGTGGATATTCTCTGCAATGACTGTAATGGACGATCCACTGTTCAG
TTTCATATATTAGGCATGAAATGTAAGATTTGTGAATCCTATAATACTGCTCAAGCTGGAGGACGTAGAA
TTTCACTGGATCAGCAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001278538
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278538.1, NP_001265467.1
RefSeq Size 4387 bp
RefSeq ORF 720 bp
Locus ID 25898
UniProt ID Q96PM5
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways p53 signaling pathway, Ubiquitin mediated proteolysis
Gene Summary The protein encoded by this gene has ubiquitin ligase activity. It mediates E3-dependent ubiquitination and proteasomal degradation of target proteins, including tumor protein 53, histone deacetylase 1, and cyclin-dependent kinase inhibitor 1B, thus regulating their levels and cell cycle progression. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (8) uses an alternate splice site in the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (6) has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...