IFNAR2 (NM_001289126) Human Untagged Clone
CAT#: SC334723
IFNAR2 (untagged) - Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 5
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IFN-alpha-REC; IFN-R; IFNABR; IFNARB; IMD45 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001289126, the custom clone sequence may differ by one or more nucleotides
ATGCTTTTGAGCCAGAATGCCTTCATCTTCAGATCACTTAATTTGGTTCTCATGGTGTATATCAGCCTCG TGTTTGGTATTTCATATGATTCGCCTGATTACACAGATGAATCTTGCACTTTCAAGATATCATTGCGAAA TTTCCGGTCCATCTTATCATGGGAATTAAAAAACCACTCCATTGTACCAACTCACTATACATTGCTGTAT ACAATCATGAGTAAACCAGAAGATTTGAAGGTGGTTAAGAACTGTGCAAATACCACAAGATCATTTTGTG ACCTCACAGATGAGTGGAGAAGCACACACGAGGCCTATGTCACCGTCCTAGAAGGATTCAGCGGGAACAC AACGTTGTTCAGTTGCTCACACAATTTCTGGCTGGCCATAGACATGTCTTTTGAACCACCAGAGTTTGAG ATTGTTGGTTTTACCAACCACATTAATGTGATGGTGAAATTTCCATCTATTGTTGAGGAAGAATTACAGT TTGATTTATCTCTCGTCATTGAAGAACAGTCAGAGGGAATTGTTAAGAAGCATAAACCCGAAATAAAAGG AAACATGAGTGGAAATTTCACCTATATCATTGACAAGTTAATTCCAAACACGAACTACTGTGTATCTGTT TATTTAGAGCACAGTGATGAGCAAGCAGTAATAAAGTCTCCCTTAAAATGCACCCTCCTTCCACCTGGCC AGGAATCAGAATTTTCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289126 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001289126.1, NP_001276055.1 |
RefSeq Size | 2789 bp |
RefSeq ORF | 720 bp |
Locus ID | 3455 |
UniProt ID | P48551 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Toll-like receptor signaling pathway |
Gene Summary | The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The protein belongs to the type II cytokine receptor family. Mutations in this gene are associated with Immunodeficiency 45. [provided by RefSeq, Jul 2020] Transcript Variant: This variant (5) lacks an alternate in-frame exon, which results in a frameshift and early termination of translation, compared to variant 1. The encoded protein (isoform c) has a shorter and distinct C-terminus, compared to isoform a. Variants 5 and 6 both encode isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...