PPP1R7 (NM_001282411) Human Untagged Clone
CAT#: SC334706
PPP1R7 (untagged) - Human protein phosphatase 1, regulatory subunit 7 (PPP1R7), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
PPP1R7 mouse monoclonal antibody, clone OTI4F9 (formerly 4F9)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SDS22 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282411, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGGAACGCGGCGCGGGGCAGCAACAGTCGCAGGAGATGATGGAGGAAGAACATGAGCTGCCTG TGGACATGGAAACCATCAACCTGGACAGAGATGCAGAGGATGTTGATTTGAATCACTATCGCATAGGGAA GATTGAAGGATTTGAGGTACTGAAGAAAGTGAAGACTCTCTGCCTCCGCCAAAATTTAATTAAATGCATT GAGAATCTGGAGGAGCTACAGAGTCTTCGAGAGCTGGATCTTTACGACAACCAGATCAAGAAGATTGAGA ATCTGGAGGCGCTAACAGAGCTGGAGATTCTAGATATTTCTTTTAATCTGCTGAGAAACATCGAAGGGGT TGACAAGTTGACACGACTGAAAAAACTCTTCTTGGTCAACAATAAAATCAGTAAAATTGAGAACTTAAGC AACTTACATCAACTACAGATGCTAGAGCTGGGATCTAACCGCATCCGGGCAATCGAAAATATCGACACCT TAACCAACCTGGAGAGTTTGTTTTTGGGGAAAAACAAAATTACTAAACTTCAGAACCTGGATGCGCTCAC CAACCTGACAGTCCTCAGTATGCAGAGCAACCGGCTGACCAAGATCGAGGGTCTGCAGAACCTGGTGAAC CTGCGGGAGCTGTACCTTAGCCACAATGGCATCGAGGTCATCGAGGGCCTGGAGAACAATGTGCAGGACA GCCTCACGTACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282411 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282411.1, NP_001269340.1 |
RefSeq Size | 1674 bp |
RefSeq ORF | 714 bp |
Locus ID | 5510 |
UniProt ID | Q15435 |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | This gene encodes a protein subunit that regulates the activity of the serine/threonine phosphatase, protein phosphatase-1. The encoded protein is required for completion of the mitotic cycle and for targeting protein phosphatase-1 to mitotic kinetochores. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (4) lacks alternate exons in the coding region and uses an alternate 3' terminal exon compared to variant 1. The encoded protein (isoform 4, also known as sds22beta2) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...