ATP6V0E2 (NM_001289990) Human Untagged Clone

CAT#: SC334698

ATP6V0E2 (untagged) - Human ATPase, H+ transporting V0 subunit e2 (ATP6V0E2), transcript variant 3



  "NM_001289990" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ATP6V0E2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATP6V0E2L; C7orf32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289990, the custom clone sequence may differ by one or more nucleotides


ATGCGCGTGCGCGGCCCGGCCCGGCTGATCGCTTCGGGTGCTCGACTCCTGTTGCGCATGCTCAGCGCGC
TGCCCGGCTGGGGACCCGCGCACCTGCAGCGCCCGCTGCTCGGCCCTGCATCCTGCCTGGGCATCCTGCG
CCCGGCCATGACGGCGCACTCATTCGCCCTCCCGGTCATCATCTTCACCACGTTCTGGGGCCTCGTCGGC
ATCGCCGGGCCCTGGTTCGTGCCGAAGGGACCCAACCGCGGAGTGATCATCACCATGCTGGTCGCCACCG
CCGTCTGCTGTTACCTCTTCTGGCTCATCGCCATCCTGGCGCAGCTGAACCCCCTGTTCGGGCCCCAGCT
GAAGAATGAGACCATCTGGTGCCCAGCTCTCGGAATGACTGTGGCTCCACTGTCCCTGACAACCCCTTCG
TCCGGACCCTCCCCCACACAACTATGTCTGGTCACCAGCTCCCTCCTGCTGGCACCCAGAGACCCGGACC
CGCAGGGCCTGCCTGGTTCCTGGAAGTCTTCCCAGTCTTCCCAGCCAGCCCGGGCCCTGGGGAGCCCTGG
GCACAGCAGCGGCCGAGGGGATGTCCTGCTCCAATACCCGCACTGCTCTGGAGTTTGCCCTCTTTCCCAA
GGAGATGCTGCTGGGGAGCTGGTATGGGTGGGGTCTTTCCCTTTACAGACGGGGCAGATGCCAGGACTCA
GCCCATCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001289990
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289990.1, NP_001276919.1
RefSeq Size 2704 bp
RefSeq ORF 711 bp
Locus ID 155066
UniProt ID Q8NHE4
Protein Pathways Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
Gene Summary Multisubunit vacuolar-type proton pumps, or H(+)-ATPases, acidify various intracellular compartments, such as vacuoles, clathrin-coated and synaptic vesicles, endosomes, lysosomes, and chromaffin granules. H(+)-ATPases are also found in plasma membranes of specialized cells, where they play roles in urinary acidification, bone resorption, and sperm maturation. Multiple subunits form H(+)-ATPases, with proteins of the V1 class hydrolyzing ATP for energy to transport H+, and proteins of the V0 class forming an integral membrane domain through which H+ is transported. ATP6V0E2 encodes an isoform of the H(+)-ATPase V0 e subunit, an essential proton pump component (Blake-Palmer et al., 2007 [PubMed 17350184]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded protein (isoform 3) has a longer and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...