KCNMB2 (NM_001278911) Human Untagged Clone

CAT#: SC334680

KCNMB2 (untagged) - Human potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2), transcript variant 3



  "NM_001278911" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-KCNMB2 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001278911, the custom clone sequence may differ by one or more nucleotides


ATGTTTATATGGACCAGTGGCCGGACCTCTTCATCTTATAGACATGATGAAAAAAGAAATATTTACCAGA
AAATCAGGGACCATGACCTCCTGGACAAAAGGAAAACAGTCACAGCACTGAAGGCAGGAGAGGACCGAGC
TATTCTCCTGGGACTGGCTATGATGGTGTGCTCCATCATGATGTATTTTCTGCTGGGAATCACACTCCTG
CGCTCATACATGCAGAGCGTGTGGACCGAAGAGTCTCAATGCACCTTGCTGAATGCGTCCATCACGGAAA
CATTTAATTGCTCCTTCAGCTGTGGTCCAGACTGCTGGAAACTTTCTCAGTACCCCTGCCTCCAGGTGTA
CGTTAACCTGACTTCTTCCGGGGAAAAGCTCCTCCTCTACCACACAGAAGAGACAATAAAAATCAATCAG
AAGTGCTCCTATATACCTAAATGTGGAAAAAATTTTGAAGAATCCATGTCCCTGGTGAATGTTGTCATGG
AAAACTTCAGGAAGTATCAACACTTCTCCTGCTATTCTGACCCAGAAGGAAACCAGAAGAGTGTTATCCT
AACAAAACTCTACAGTTCCAACGTGCTGTTCCATTCACTCTTCTGGCCAACCTGTATGATGGCTGGGGGT
GTGGCAATTGTTGCCATGGTGAAACTTACACAGTACCTCTCCCTACTATGTGAGAGGATCCAACGGATCA
ATAGATAA


Restriction Sites SgfI-MluI     
ACCN NM_001278911
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278911.1, NP_001265840.1
RefSeq Size 2569 bp
RefSeq ORF 708 bp
Locus ID 10242
UniProt ID Q9Y691
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Protein Pathways Vascular smooth muscle contraction
Gene Summary MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which decreases the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants of this gene. Additional variants are discussed in the literature, but their full length nature has not been described. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...