C18orf10 (TPGS2) (NM_001271953) Human Untagged Clone

CAT#: SC334655

TPGS2 (untagged) - Human tubulin polyglutamylase complex subunit 2 (TPGS2), transcript variant 6



  "NM_001271953" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-TPGS2 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C18orf10; HMFN0601; L17; PGs2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001271953, the custom clone sequence may differ by one or more nucleotides


ATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTGCAGCAAGCCGCACCTGGAGAAGCTGACCCTGGGCA
TCACGCGCATCCTAGAATCTTCCCCAGGTGTGACTGAGGTGACCATCATAGAAAAGCCTCCTGCTGAACG
TCATATGATTTCTTCCTGGGAACAAAAGAATAACTGTGTGATGCCTGAAGATGTGAAGAACTTTTACCTG
ATGACCAATGGCTTCCACATGACATGGAGTGTGAAGCTGGATGAGCACATCATTCCACTGGGAAGCATGG
CAATTAACAGCATCTCAAAACTGACTCAGCTCACCCAGTCTTCCATGTATTCACTTCCTAATGCACCCAC
TCTGGCAGACCTGGAGGACGATACACATGAAGCCAGTGATGATCAGCCAGAGAAGCCTCACTTTGACTCT
CGCAGTGTGATATTTGAGCTGGATTCATGCAATGGCAGTGGGAAAGTTTGCCTTGTCTACAAAAGTGGGA
AACCAGCATTAGCAGAAGACACTGAGATCTGGTTCCTGGACAGAGCGTTATACTGGCATTTTCTCACAGA
CACCTTTACTGCCTATTACCGCCTGCTCATCACCCACCTGGGCCTGCCCCAGTGGCAATATGCCTTCACC
AGCTATGGCATTAGCCCACAGGCCAAGGCATGGGGACTGGCCACAAGCAAAGAGTCAGCAGCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001271953
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271953.1, NP_001258882.1
RefSeq Size 1315 bp
RefSeq ORF 696 bp
Locus ID 25941
Gene Summary This gene encodes a protein that is a component of the neuronal polyglutamylase complex, which plays a role in post-translational addition of glutamate residues to C-terminal tubulin tails. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (6) contains an alternate 3' terminal exon compared to variant 1. It encodes isoform 6 which has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...