NPL (NM_001200052) Human Untagged Clone
CAT#: SC334644
NPL (untagged) - Human N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 5
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C1orf13; C112; NAL; NPL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001200052, the custom clone sequence may differ by one or more nucleotides
ATGGCCTTCCCAAAGAAGAAACTTCAGGGTCTTGTGGCTGCAACCATCACGCCAATGACTGAGAATGGAG AAATCAACTTTTCAGTAATTGGTCAGTATGTGGATTATCTTGTGAAAGAACAGGGAGTGAAGAACATTTT TGTGAATGGCACAACAGGAGAAGGCCTGTCCCTGAGCGTCTCAGAGCGTCGCCAGGTTGCAGAGGAGTGG GTGACAAAAGGGAAGGACAAGCTGGATCAGGTGATAATTCACGTAGGAGCACTGAGCTTGAAGGAGTCAC AGGAACTGGCCCAACATGCAGCAGAAATAGGAGCTGATGGCATCGCTGTCATTGCACCGTTCTTCCTCAA GCCATGGACCAAAGATATCCTGATTAATTTCCTAAAGGAAGTGGCTGCTGCCGCCCCTGCCCTGCCATTT TATTACTATCACATTCCTGCCTTGACAGGGGTAAAGATTCGTGCTGAGGAGTTGTTGGATGGGATTCTGG ATAAGATCCCCACCTTCCAAGGGCTGAAATTCAGTGATACAGATCTCTTAGACTTCGGGCAATGTGTTGA TCAGAATCGCCAGCAACAGTTTGCTTTCCTTTTTGGGGTGGATGAGCAACTGTTGAGTGCTCTGGTGATG GGAGCAACTGGAGCAGTGGGCAGTTTTGTATCCAGAGATTTATCAACTTTGTTGTCAAACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001200052 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001200052.1, NP_001186981.1 |
RefSeq Size | 2782 bp |
RefSeq ORF | 693 bp |
Locus ID | 80896 |
Protein Pathways | Amino sugar and nucleotide sugar metabolism |
Gene Summary | This gene encodes a member of the N-acetylneuraminate lyase sub-family of (beta/alpha)(8)-barrel enzymes. N-acetylneuraminate lyases regulate cellular concentrations of N-acetyl-neuraminic acid (sialic acid) by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (5) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236750 | NPL (myc-DDK-tagged) - Human N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 5 |
CNY 3,990.00 |
|
RG236750 | NPL (tGFP-tagged) - Human N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 5 |
CNY 4,370.00 |