LRAT (NM_001301645) Human Untagged Clone

CAT#: SC334641

LRAT (untagged) - Human lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) (LRAT), transcript variant 2



  "NM_001301645" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-LRAT antibody
    • 100 ul

CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LCA14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301645, the custom clone sequence may differ by one or more nucleotides


ATGAAGAACCCCATGCTGGAGGTGGTGTCTTTACTACTGGAGAAGCTGCTCCTCATCTCCAACTTCACGC
TCTTTAGTTCGGGCGCCGCGGGCGAAGACAAAGGGAGGAACAGTTTTTATGAAACCAGCTCTTTCCACCG
AGGCGACGTGCTGGAGGTGCCCCGGACCCACCTGACCCACTATGGCATCTACCTAGGAGACAACCGTGTT
GCCCACATGATGCCCGACATCCTGTTGGCCCTGACAGACGACATGGGGCGCACGCAGAAGGTGGTCTCCA
ACAAGCGTCTCATCCTGGGCGTTATTGTCAAAGTGGCCAGCATCCGCGTGGACACAGTGGAGGACTTCGC
CTACGGAGCTAACATCCTGGTCAATCACCTGGACGAGTCCCTCCAGAAAAAGGCACTGCTCAACGAGGAG
GTGGCGCGGAGGGCTGAAAAGCTGCTGGGCTTTACCCCCTACAGCCTGCTGTGGAACAACTGCGAGCACT
TCGTGACCTACTGCAGATATGGCACCCCGATCAGTCCCCAGTCCGACAAGTTTTGTGAGACTGTGAAGAT
AATTATTCGTGATCAGAGAAGTGTTCTTGCTTCAGCAGTCTTGGGATTGGCGTCTATAGTCTGTACGGGC
TTGGTATCATACACTACCCTTCCTGCAATTTTTATTCCATTCTTCCTATGGATGGCTGGCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001301645
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301645.1, NP_001288574.1
RefSeq Size 4735 bp
RefSeq ORF 693 bp
Locus ID 9227
UniProt ID O95237
Protein Families Druggable Genome, Transmembrane
Protein Pathways Retinol metabolism
Gene Summary The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...