SLC35C2 (NM_001281459) Human Untagged Clone
CAT#: SC334635
SLC35C2 (untagged) - Human solute carrier family 35 (GDP-fucose transporter), member C2 (SLC35C2), transcript variant 6
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BA394O2.1; C20orf5; CGI-15; OVCOV1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001281459, the custom clone sequence may differ by one or more nucleotides
ATGACCAAATCCTCAGCTGTCCTCTTCATCTTGATCTTCTCTCTGATCTTCAAGCTGGAGGAGCTGTCCA CACAGTTCAACGTGGAGGGCTTCGCCTTGGTGCTGGGGGCCTCGTTCATCGGTGGCATTCGCTGGACCCT CACCCAGATGCTCCTGCAGAAGGCTGAACTCGGCCTCCAGAATCCCATCGACACCATGTTCCACCTGCAG CCACTCATGTTCCTGGGGCTCTTCCCTCTCTTTGCTGTATTTGAAGGTCTCCATTTGTCCACATCTGAGA AAATCTTCCGTTTCCAGGACACAGGGCTGCTCCTGCGGGTACTTGGGAGCCTCTTCCTTGGCGGGATTCT CGCCTTTGGTTTGGGCTTCTCTGAGTTCCTCCTGGTCTCCAGAACCTCCAGCCTCACTCTCTCCATTGCC GGCATTTTTAAGGAAGTCTGCACTTTGCTGTTGGCAGCTCATCTGCTGGGCGATCAGATCAGCCTCCTGA ACTGGCTGGGCTTCGCCCTCTGCCTCTCGGGAATATCCCTCCACGTTGCCCTCAAAGCCCTGCATTCCAG AGGTGATGGTGGCCCCAAGGCCTTGAAGGGGCTGGGCTCCAGCCCCGACCTGGAGCTGCTGCTCCGGAGC AGCCAGCGGGAGGAAGGTGACAATGAGGAGGAGGAGTACTTTGTGGCCCAGGGGCAGCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281459 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001281459.1, NP_001268388.1 |
RefSeq Size | 2191 bp |
RefSeq ORF | 693 bp |
Locus ID | 51006 |
UniProt ID | Q9NQQ7 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the triose-phosphate transporter protein family. This gene is regulated by oxygen tension, is induced in hypoxic trophoblast cells, and is overexpressed in ovarian cancer. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (6) has multiple differences in the 5' UTR and 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (e) is shorter, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236741 | SLC35C2 (myc-DDK-tagged) - Human solute carrier family 35 (GDP-fucose transporter), member C2 (SLC35C2), transcript variant 6 |
CNY 3,990.00 |
|
RG236741 | SLC35C2 (tGFP-tagged) - Human solute carrier family 35 (GDP-fucose transporter), member C2 (SLC35C2), transcript variant 6 |
CNY 4,370.00 |
其它SLC35C2产品