RG9MTD3 (TRMT10B) (NM_001286952) Human Untagged Clone

CAT#: SC334633

TRMT10B (untagged) - Human tRNA methyltransferase 10 homolog B (S. cerevisiae) (TRMT10B), transcript variant 4



  "NM_001286952" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-RG9MTD3 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA3J10.9; RG9MTD3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286952, the custom clone sequence may differ by one or more nucleotides


ATGGACTGGAAATTGGAAGGGAGTACTCAGAAAGTAGAGTCACCTGTGCTGCAGGGGCAAGAAGGCATCC
TAGAGGAGACAGGTGAAGATGGACTTCCTGAAGGCTTCCAGCTTCTGCAGATCGATGCGGAAGGCGAGTG
CCAGGAGGGAGAGATCCTGGCCACAGGCAGTACGGCATGGTGCTCGGAATTAAGTAGACTGGCTGGACAG
ATTCGAAGGTTGTATGGTTCAAACAAAAAAGCTGACAGGCCATTTTGGATCTGCCTCACTGGATTCACAA
CAGACAGTCCCCTTTATGAAGAGTGTGTGAGGATGAATGATGGATTTTCTAGTTACCTGTTAGACATAAC
AGAAGAAGACTGCTTTAGTTTATTTCCCTTGGAAACCCTTGTGTACCTGACTCCTGACTCAGAACACGCT
CTTGAAGATGTTGATCTAAACAAAGTTTACATCCTCGGTGGGCTTGTGGATGAAAGCATTCAGAAGAAGG
TGACATTTCAAAAGGCCCGGGAATACTCTGTCAAGACCGCACGCTTGCCAATCCAGGAATACATGGTCAG
AAACCAGAATGGGAAAAACTATCATTCAGAGATACTGGCCATCAATCAAGAGACTCACAACTGGCCTGAA
GCATTGAAGAAAGGAGTTTCTTCAGGAAAAGGCTATATTCTTCGGAACTCAGTGGAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001286952
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286952.1, NP_001273881.1
RefSeq Size 2049 bp
RefSeq ORF 690 bp
Locus ID 158234
UniProt ID Q6PF06
Gene Summary S-adenosyl-L-methionine-dependent guanine N(1)-methyltransferase that catalyzes the formation of N(1)-methylguanine at position 9 (m1G9) in tRNAs (PubMed:23042678). Probably not able to catalyze formation of N(1)-methyladenine at position 9 (m1A9) in tRNAs (PubMed:23042678).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks two alternate exons that result in the loss of an in-frame segment in the 5' coding region, and it uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (d) is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...