Regucalcin (RGN) (NM_001282849) Human Untagged Clone
CAT#: SC334617
RGN (untagged) - Human regucalcin (RGN), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Cited in 1 publication. |
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GNL; HEL-S-41; RC; SMP30 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282849, the custom clone sequence may differ by one or more nucleotides
ATGTCTTCCATTAAGATTGAGTGTGTTTTGCCAGAGAACTGCCGGTGTGGTGAGTCTCCAGTATGGGAGG AAGTGTCCAACTCTCTGCTCTTTGTAGACATTCCTGCAAAAAAGGTTTGCCGGTGGGATTCATTCACCAA GCAAGTACAGCGAGTGACCATGGATGCCCCAGTCAGCTCCGTGGCTCTTCGCCAGTCGGGAGGCTATGTT GCCACCATTGGAACAAAGTTCTGTGCTTTGAACTGGAAAGAACAATCAGCAGTTGTCTTGGCCACGGTGG ATAACGACAAGAAAAACAATCGCTTCAATGATGGGAAGGTGGATCCCGCCGGGAGGTACTTTGCTGCCAA CCGCAGAAGTGTTTACAAGCTAGAAAAGGAAGAACAAATCCCAGATGGAATGTGTATTGATGCTGAGGGG AAGCTCTGGGTGGCCTGTTACAATGGAGGAAGAGTGATTCGTTTAGATCCTGTGACAGGGAAAAGACTTC AAACTGTGAAGTTGCCTGTTGATAAAACAACTTCATGCTGCTTTGGAGGGAAGAATTACTCTGAAATGTA TGTGACCTGCGCCCGGGATGGGATGGACCCCGAGGGTCTTTTGAGGCAACCTGAAGCTGGTGGAATTTTC AAGATAACTGGTCTGGGGGTCAAAGGAATTGCTCCCTACTCCTATGCGGGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282849 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282849.1, NP_001269778.1 |
RefSeq Size | 2041 bp |
RefSeq ORF | 684 bp |
Locus ID | 9104 |
UniProt ID | Q15493 |
Gene Summary | The protein encoded by this gene is a highly conserved, calcium-binding protein, that is preferentially expressed in the liver and kidney. It may have an important role in calcium homeostasis. Studies in rat indicate that this protein may also play a role in aging, as it shows age-associated down-regulation. This gene is part of a gene cluster on chromosome Xp11.3-Xp11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (4) lacks an alternate in-frame exon in the 5' coding region, compared to variant 2. It encodes isoform 3, which is shorter than isoform 1. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Regucalcin ameliorates doxorubicin-induced cytotoxicity in Cos-7 kidney cells and translocates from the nucleus to the mitochondria
,null,
Bioscience Reports
,PubMed ID 34904631
[RGN]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Regucalcin产品
Customer
Reviews
Loading...