Glutathione S Transferase theta 1 (GSTT1) (NM_001293807) Human Untagged Clone
CAT#: SC334612
GSTT1 (untagged) - Human glutathione S-transferase theta 1 (GSTT1), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001293807, the custom clone sequence may differ by one or more nucleotides
ATGGGCCTGGAGCTGTACCTGGACCTGCTGTCCCAGCCCTGCCGCGCTGTTTACATCTTTGCCAAGAAGA ACGACATTCCCTTCGAGCTGCGCATCGTGGATCTGATTAAAGACGGAGTCTCGCTCTGTCGCCCAGGCTG GAGTGCAGTGGCAGGATCACAGCTCACTGCAACCTCTGCCGCCCGAAACCTTGTCCTCTGCCTCTTGTTC CTGCTGGGGAGGTCAGCACTTAAGCGATGCCTTTGCCCAGGTGAACCCCCTCAAGAAGGTGCCAGCCTTG AAGGACGGGGACTTCACCTTGACGGAGAGGTGATGTTCCCTGTTTTCCTGGGTGAGCCAGTATCTCCCCA GACACTGGCAGCCACCCTGGCAGAGTTGGATGTGACCCTGCAGTTGCTCGAGGACAAGTTCCTCCAGAAC AAGGCCTTCCTTACTGGTCCTCACATCTCCTTAGCTGACCTCGTAGCCATCACGGAGCTGATGCATCCCG TGGGTGCTGGCTGCCAAGTCTTCGAAGGCCGACCCAAGCTGGCCACATGGCGGCAGCGCGTGGAGGCAGC AGTGGGGGAGGACCTCTTCCAGGAGGCCCATGAGGTCATTCTGAAGGCCAAGGACTTCCCACCTGCAGAC CCCACCATAAAGCAGAAGCTGATGCCCTGGGTGCTGGCCATGATCCGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001293807 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001293807.1, NP_001280736.1 |
RefSeq Size | 1067 bp |
RefSeq ORF | 681 bp |
Locus ID | 2952 |
UniProt ID | P30711 |
Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
Gene Summary | The protein encoded by this gene, glutathione S-transferase (GST) theta 1 (GSTT1), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT1 and GSTT2/GSTT2B share 55% amino acid sequence identity and may play a role in human carcinogenesis. The GSTT1 gene is haplotype-specific and is absent from 38% of the population. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (2) contains an additional exon but lacks a different exon, which results in a frameshifted segment in the 5' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Glutathione S Transferase theta 1产品
Customer
Reviews
Loading...