Pirh2 (RCHY1) (NM_001278536) Human Untagged Clone

CAT#: SC334575

RCHY1 (untagged) - Human ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase (RCHY1), transcript variant 6



  "NM_001278536" in other vectors (2)

CN¥ 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-RCHY1 Rabbit Polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARNIP; CHIMP; PIRH2; PRO1996; RNF199; ZCHY; ZNF363
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278536, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGACGGCCCGGGAAGATGGCGCCAGCGGTCAAGAGCGAGGTCAGCGGGGCTGCGAGCACTATG
ACAGAGGATGTCTCCTAAAGGCCCAACAGACTTGTGAAGAATGTAGCACATTGTTTGGAGAATATTATTG
CGATATATGCCATTTGTTTGACAAAGATAAGAAGCAGTATCACTGTGAAAACTGTGGAATTTGTAGGATT
GGTCCAAAGGAAGATTTTTTCCATTGTTTGAAATGTAACTTATGCCTAGCTATGAATCTTCAAGGAAGAC
ACAAGTGTATTGAAAATGTGTCCCGACAGAATTGTCCAATATGTTTGGAGGACATTCACACATCCCGTGT
TGTTGCTCATGTCTTGCCATGTGGACATCTTTTACATAGAACGTGTTATGAAGAAATGTTGAAAGAAGGC
TACAGATGTCCATTATGTATGCACTCTGCTTTAGATATGACCAGGTATTGGAGACAGCTGGATGATGAAG
TAGCACAGACTCCTATGCCATCAGAATATCAGAACATGACTGTGGATATTCTCTGCAATGACTGTAATGG
ACGATCCACTGTTCAGTTTCATATATTAGGCATGAAATGTAAGATTTGTGAATCCTATAATACTGCTCAA
GCTGGAGGACGTAGAATTTCACTGGATCAGCAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001278536
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278536.1, NP_001265465.1
RefSeq Size 4311 bp
RefSeq ORF 666 bp
Locus ID 25898
UniProt ID Q96PM5
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways p53 signaling pathway, Ubiquitin mediated proteolysis
Gene Summary The protein encoded by this gene has ubiquitin ligase activity. It mediates E3-dependent ubiquitination and proteasomal degradation of target proteins, including tumor protein 53, histone deacetylase 1, and cyclin-dependent kinase inhibitor 1B, thus regulating their levels and cell cycle progression. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (6) lacks an in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (4) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...