VAP1 (AOC3) (NM_001277732) Human Untagged Clone

CAT#: SC334559

AOC3 (untagged) - Human amine oxidase, copper containing 3 (AOC3), transcript variant 3



  "NM_001277732" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal AOC3 Antibody (Center)
    • 400 ul

CNY 6,160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HPAO; SSAO; VAP-1; VAP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001277732, the custom clone sequence may differ by one or more nucleotides


ATGGTCTTTGTCCCCATGGCTGTGCCCTGGAGCCCTGAGCACCAGCTGCAGAGGCTGCAGGTGACCCGGA
AGCTGCTGGAGATGGAGGAGCAGGCCGCCTTCCTCGTGGGAAGCGCCACCCCTCGCTACCTGTACCTGGC
CAGCAACCACAGCAACAAGTGGGGTCACCCCCGGGGCTACCGCATCCAGATGCTCAGCTTTGCTGGAGAG
CCGCTGCCCCAAAACAGCTCCATGGCGAGAGGCTTCAGCTGGGAGAGGTACCAGCTGGCTGTGACCCAGC
GGAAGGAGGAGGAGCCCAGTAGCAGCAGCGTTTTCAATCAGAATGACCCTTGGGCCCCCACTGTGGATTT
CAGTGACTTCATCAACAATGAGACCATTGCTGGAAAGGATTTGGTGGCCTGGGTGACAGCTGGTTTTCTG
CATATCCCACATGCAGAGGACATTCCTAACACAGTGACTGTGGGGAACGGCGTGGGCTTCTTCCTCCGAC
CCTATAACTTCTTTGACGAAGACCCCTCCTTCTACTCTGCCGACTCCATCTACTTCCGAGGGGACCAGGA
TGCTGGGGCCTGCGAGGTCAACCCCCTAGCTTGCCTGCCCCAGGCTGCTGCCTGTGCCCCCGACCTCCCT
GCCTTCTCCCACGGGGGCTTCTCTCACAACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001277732
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001277732.1, NP_001264661.1
RefSeq Size 2412 bp
RefSeq ORF 663 bp
Locus ID 8639
UniProt ID Q16853
Protein Families Transmembrane
Protein Pathways beta-Alanine metabolism, Glycine, serine and threonine metabolism, Metabolic pathways, Phenylalanine metabolism, Tyrosine metabolism
Gene Summary This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Transcript Variant: This variant (3) contains a distinct 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...