TRAP alpha (SSR1) (NM_001292008) Human Untagged Clone

CAT#: SC334549

SSR1 (untagged) - Human signal sequence receptor, alpha (SSR1), transcript variant 2



  "NM_001292008" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SSR1 (TRAP alpha) mouse monoclonal antibody, clone OTI4C7 (formerly 4C7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TRAPA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001292008, the custom clone sequence may differ by one or more nucleotides


ATGAGACTCCTCCCCCGCTTGCTGCTGCTTCTCTTACTCGTGTTCCCTGCCACTGTCTTGTTCCGAGGCG
GCCCCAGAGGCTTGTTAGCAGTGGCACAAGATCTTACAGAGGATGAAGAAACAGTAGAAGATTCCATAAT
TGAGGATGAAGATGATGAAGCCGAGGTAGAAGAAGATGAACCCACAGATTTGGTAGAAGATAAAGAGGAA
GAAGATGTGTCTGGTGAACCTGAAGCTTCACCGAGTGCAGATACAACTATACTGTTTGTAAAAGGAGAAG
AGCCCATGGGCGGACGACCATTTGGTTTGGTCATCAATCTGAACTACAAAGATTTGAACGGCAATGTATT
CCAAGATGCAGTCTTCAATCAAACAGTTACAGTTATTGAAAGAGAGGATGGGTTAGATGGAGAAACAATC
TTTATGTATATGTTCCTTGCTGGTCTTGGGCTTCTGGTTATTGTTGGCCTTCATCAACTCCTAGAATCTA
GAAAGCGTAAGAGACCCATACAGAAAGTAGAAATGGGTACATCAAGTCAGAATGATGTTGACATGAGTTG
GATTCCTCAGGAAACATTGAATCAAATCAATAAAGCTTCACCAAGAAGGTTGCCCAGGAAACGGGCACAG
AAGAGATCAGTGGGATCTGATGAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001292008
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001292008.1, NP_001278937.1
RefSeq Size 9589 bp
RefSeq ORF 657 bp
Locus ID 6745
UniProt ID P43307
Protein Families Druggable Genome, Transmembrane
Gene Summary The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein. This gene generates several mRNA species as a result of complex alternative polyadenylation. This gene is unusual in that it utilizes arrays of polyA signal sequences that are mostly non-canonical. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1.The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...