AMD1 (NM_001287216) Human Untagged Clone

CAT#: SC334521

AMD1 (untagged) - Human adenosylmethionine decarboxylase 1 (AMD1), transcript variant 5



  "NM_001287216" in other vectors (2)

CN¥ 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


Anti-AMD1 Rabbit Polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ADOMETDC; AMD; SAMDC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287216, the custom clone sequence may differ by one or more nucleotides


ATGGAAGCTGCACATTTTTTCGAAGGGACCGAGAAGCTGCTGGAGGTTTGGTTCTCCCGGCAGCAGCCCG
ACGCAAACCAAGGATCTGGGGATCTTCGCACTATCCCAAGGTACTTATATACTCTGGATTTCCCAGAGAG
TCGGGTAATCAGTCAGCCAGATCAAACCTTGGAAATTCTGATGAGTGAGCTTGACCCAGCAGTTATGGAC
CAGTTCTACATGAAAGATGGTGTTACTGCAAAGGATGTCACTCGTGAGAGTGGAATTCGTGACCTGATAC
CAGGTTCTGTCATTGATGCCACAATGTTCAATCCTTGTGGGTATTCGATGAATGGAATGAAATCGGATGG
AACTTATTGGACTATTCACATCACTCCAGAACCAGAATTTTCTTATGTTAGCTTTGAAACAAACTTAAGT
CAGACCTCCTATGATGACCTGATCAGGAAAGTTGTAGAAGTCTTCAAGCCAGGAAAATTTGTGACCACCT
TGTTTGTTAATCAGAGTTCTAAATGTCGCACAGTGCTTGCTTCGCCCCAGAAGATTGAAGGTTTTAAGCG
TCTTGATTGCCAGAGTGCTATGTTCAATGATTACAATTTTGTTTTTACCAGTTTTGCTAAGAAGCAGCAA
CAACAGCAGAGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001287216
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001287216.1, NP_001274145.1
RefSeq Size 3077 bp
RefSeq ORF 645 bp
Locus ID 262
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Cysteine and methionine metabolism, Metabolic pathways
Gene Summary This gene encodes an important intermediate enzyme in polyamine biosynthesis. The polyamines spermine, spermidine, and putrescine are low-molecular-weight aliphatic amines essential for cellular proliferation and tumor promotion. Multiple alternatively spliced transcript variants have been identified. Pseudogenes of this gene are found on chromosomes 5, 6, 10, X and Y. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (5) lacks consecutive four exons in the coding region, but maintains the reading frame, compared to variant 1. The resulting isoform (5) lacks an internal segment, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...