CEACAM3 (NM_001277163) Human Untagged Clone

CAT#: SC334500

CEACAM3 (untagged) - Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3), transcript variant 2



  "NM_001277163" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CEACAM3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD66D; CEA; CGM1; W264; W282
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001277163, the custom clone sequence may differ by one or more nucleotides


ATGGGGCCCCCCTCAGCCTCTCCCCACAGAGAATGCATCCCCTGGCAGGGGCTTCTGCTCACAGCCTCAC
TTCTAAACTTCTGGAACCCGCCCACCACTGCCAAGCTCACTATTGAATCCATGCCGCTCAGTGTCGCAGA
GGGGAAGGAGGTGCTTCTACTTGTCCACAATCTGCCCCAGCATCTTTTTGGCTACAGCTGGTACAAAGGG
GAAAGAGTGGATGGCAACAGTCTAATTGTAGGATATGTAATAGGAACTCAACAAGCTACCCCAGGGGCCG
CATACAGCGGTCGAGAGACAATATACACCAATGCATCCCTGCTGATCCAGAATGTCACCCAGAATGACAT
AGGATTCTACACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACTGGACAGTTCCATGTA
TACCAAGAAAATGCCCCAGGCCTTCCTGTGGGGGCCGTCGCCGGCATCGTGACCGGGGTCCTGGTCGGAG
TGGCGCTGGTGGCCGCGCTGGTGTGTTTCCTGCTCCTTGCCAAAACTGGAAGGCCGTGGTCCCTCCCACA
GCTCTGCCTTCTCGATGTCCCCTCTCTCCACTGCCCAGGCCCCCCTACCCAACCCCAGGACAGCAGCTTC
CATCTATGA


Restriction Sites SgfI-MluI     
ACCN NM_001277163
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277163.2, NP_001264092.1
RefSeq Size 1058 bp
RefSeq ORF 639 bp
Locus ID 1084
UniProt ID P40198
Protein Families Transmembrane
Gene Summary This gene encodes a member of the family of carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), which are used by several bacterial pathogens to bind and invade host cells. The encoded transmembrane protein directs phagocytosis of several bacterial species that is dependent on the small GTPase Rac. It is thought to serve an important role in controlling human-specific pathogens by the innate immune system. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (2) lacks an alternate coding exon and has an alternate splice site in the 3' region, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...