WDR61 (NM_001303248) Human Untagged Clone

CAT#: SC334497

WDR61 (untagged) - Human WD repeat domain 61 (WDR61), transcript variant 3



  "NM_001303248" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


WDR61 mouse monoclonal antibody, clone OTI2H10 (formerly 2H10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms REC14; SKI8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001303248, the custom clone sequence may differ by one or more nucleotides


ATGACCAACCAGTACGGTATTCTCTTCAAACAAGAGCAAGTGGATGCCTGGACTTTGGCCTTTTCTCCTG
ATTCCCAGTATCTGGCCACAGGAACTCATGTCGGGAAAGTGAACATTTTTGGTGTGGAAAGTGGGAAAAA
GGAATATTCTTTGGACACGAGAGGAAAATTCATTCTTAGTATTGCATATAGTCCTGATGGGAAATACCTA
GCCAGTGGAGCCATAGATGGAATCATCAATATTTTTGATATTGCAACTGGAAAACTTCTGCATACCCTGG
AAGGCCATGCCATGCCCATTCGCTCCTTGACCTTTTCCCCGGACTCCCAGCTCCTTGTCACTGCTTCAGA
TGATGGCTACATCAAGATCTATGATGTACAACATGCCAATTTGGCTGGCACGCTGAGCGGCCATGCCTCC
TGGGTGCTGAACGTTGCATTCTGTCCTGATGACACTCACTTTGTTTCCAGTTCGTCTGACAAAAGTGTAA
AAGTTTGGGATGTTGGAACGAGGACTTGTGTTCACACCTTCTTTGATCACCAGGATCAGGTCTGGGGAGT
AAAATACAATGGAAATGGTTCAAAAATTGTGTCTGTTGGAGATGACCAGGAAATTCACATCTATGATTGT
CCAATTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001303248
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001303248.1, NP_001290177.1
RefSeq Size 1054 bp
RefSeq ORF 639 bp
Locus ID 80349
UniProt ID Q9GZS3
Protein Pathways RNA degradation
Gene Summary WDR61 is a subunit of the human PAF and SKI complexes, which function in transcriptional regulation and are involved in events downstream of RNA synthesis, such as RNA surveillance (Zhu et al., 2005 [PubMed 16024656]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks an alternate in-frame pair of exons in the middle of the transcript compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...