GBGT1 (NM_001288573) Human Untagged Clone
CAT#: SC334492
GBGT1 (untagged) - Human globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (GBGT1), transcript variant 5
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | A3GALNT; FS; UNQ2513 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001288573, the custom clone sequence may differ by one or more nucleotides
ATGCGTGGGTACCGGGTGCACTACTACATCTTCACTGACAACCCTGCAGCCGTTCCCGGGGTCCCGCTGG GTCCCCACCGGCTTCTCAGCTCCATCCCCATCCAGGGTCACTCCCACTGGGAGGAGACATCCATGCGCCG GATGGAGACCATCAGCCAGCACATTGCTAAGAGGGCTCACCGGGAGGTGGACTACCTCTTCTGCCTTGAT GTGGACATGGTGTTTCGGAACCCGTGGGGCCCTGAGACCTTGGGAGACCTGGTGGCTGCCATTCACCCAA GCTACTACGCCGTTCCCCGCCAGCAGTTCCCCTATGAGCGCAGGCGTGTTTCCACTGCCTTTGTGGCAGA CAGCGAAGGGGACTTCTATTATGGTGGGGCAGTCTTCGGGGGGCAGGTGGCCAGGGTATATGAGTTTACT AGGGGCTGCCACATGGCCATCCTGGCGGACAAGGCCAATGGCATCATGGCTGCCTGGCGGGAGGAAAGCC ACCTGAACCGTCACTTCATCTCAAACAAGCCGTCCAAGGTGCTGTCCCCCGAGTACCTCTGGGACGACAG GAAGCCCCAGCCACCCAGCCTGAAGCTGATCCGCTTTTCTACACTGGACAAGGATATCAGCTGCCTGAGG AGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001288573 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001288573.1, NP_001275502.1 |
RefSeq Size | 2035 bp |
RefSeq ORF | 636 bp |
Locus ID | 26301 |
UniProt ID | Q8N5D6 |
Protein Families | Transmembrane |
Protein Pathways | Glycosphingolipid biosynthesis - globo series, Metabolic pathways |
Gene Summary | This gene encodes a glycosyltransferase that plays a role in the synthesis of Forssman glycolipid (FG), a member of the globoseries glycolipid family. Glycolipids such as FG form attachment sites for the binding of pathogens to cells; expression of this protein may determine host tropism to microorganisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013] Transcript Variant: This variant (5) uses an alternate splice site in the 3' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (5) has a shorter N-terminus than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236598 | GBGT1 (myc-DDK-tagged) - Human globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (GBGT1), transcript variant 5 |
CNY 3,990.00 |
|
RG236598 | GBGT1 (tGFP-tagged) - Human globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (GBGT1), transcript variant 5 |
CNY 4,370.00 |