ATP1B2 (NM_001303263) Human Untagged Clone
CAT#: SC334473
ATP1B2 (untagged) - Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2), transcript variant 2
CNY 2,640.00
CNY 2,950.00
货期*
现货
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AMOG |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001303263, the custom clone sequence may differ by one or more nucleotides
ATGATTCGCCCCAAGACTGAGAACCTTGATGTCATTGTCAATGTCAGTGACACTGAAAGCTGGGACCAGC ATGTTCAGAAGCTCAACAAGTTCTTGGAGCCTTACAACGACTCTATCCAAGCCCAAAAGAATGATGTCTG CCGCCCTGGACGCTATTACGAACAGCCAGATAATGGAGTCCTCAACTACCCCAAACGTGCCTGCCAATTC AACCGGACCCAGCTGGGCAACTGCTCCGGCATTGGGGACTCCACCCACTATGGTTACAGCACTGGGCAGC CCTGTGTCTTCATCAAGATGAACCGGGTCATCAACTTCTATGCAGGAGCAAACCAGAGCATGAATGTTAC CTGTGCTGGGAAGCGAGATGAAGATGCTGAGAATCTCGGCAACTTCGTCATGTTCCCCGCCAACGGCAAC ATCGACCTCATGTACTTCCCCTACTATGGCAAAAAGTTCCACGTGAACTACACACAGCCCCTGGTGGCTG TGAAGTTCCTGAATGTGACCCCCAACGTGGAGGTGAATGTAGAATGTCGCATCAACGCCGCCAACATCGC CACAGACGATGAGCGAGACAAGTTCGCCGGCCGCGTGGCCTTCAAACTCCGCATCAACAAAACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303263 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001303263.1, NP_001290192.1 |
RefSeq Size | 2601 bp |
RefSeq ORF | 627 bp |
Locus ID | 482 |
UniProt ID | P14415 |
Protein Families | Transmembrane |
Protein Pathways | Cardiac muscle contraction |
Gene Summary | The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 2 subunit. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (2) uses an upstream exon in place of the first two exons and initiates translation at a downstream site compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...