UBE2E3 (NM_001278554) Human Untagged Clone
CAT#: SC334462
UBE2E3 (untagged) - Human ubiquitin-conjugating enzyme E2E 3 (UBE2E3), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images

经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UBCH9; UbcM2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001278554, the custom clone sequence may differ by one or more nucleotides
ATGTCCAGTGATAGGCAAAGGTCCGATGATGAGAGCCCCAGCACCAGCAGTGGCAGTTCAGATGCGGACC AGCGAGACCCAGCCGCTCCAGAGCCTGAAGAACAAGAGGAAAGAAAACCTTCTGCCACCCAGCAGAAGAA AAACACCAAACTCTCTAGCAAAACCACTGCTAAGTTATCCACTAGTGCTAAAAGAATTCAGAAGGAGCTA GCTGAAATAACCCTTGATCCTCCTCCTAATTGCAGTGCTGGGCCTAAAGGAGATAACATTTATGAATGGA GATCAACTATACTTGGTCCACCGGGTTCTGTATATGAAGGTGGTGTGTTTTTTCTGGATATCACATTTTC ATCAGATTATCCATTTAAGCCACCAAAGGTTACTTTCCGCACCAGAATCTATCACTGCAACATCAACAGT CAGGGAGTCATCTGTCTGGACATCCTTAAAGACAACTGGAGTCCCGCTTTGACTATTTCAAAGGTTTTGC TGTCTATTTGTTCCCTTTTGACAGACTGCAACCCTGCGGATCCTCTGGTTGGAAGCATAGCCACTCAGTA TTTGACCAACAGAGCAGAACACGACAGGATAGCCAGACAGTGGACCAAGAGATACGCAACATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278554 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278554.1, NP_001265483.1 |
RefSeq Size | 1557 bp |
RefSeq ORF | 624 bp |
Locus ID | 10477 |
UniProt ID | Q969T4 |
Protein Pathways | Ubiquitin mediated proteolysis |
Gene Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse and rat counterparts, which indicates that this enzyme is highly conserved in eukaryotes. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (3) has an alternate 5' UTR exon, compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...