TRIB1 (NM_001282985) Human Untagged Clone

CAT#: SC334452

TRIB1 (untagged) - Human tribbles pseudokinase 1 (TRIB1), transcript variant 2



  "NM_001282985" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TRIB1 mouse monoclonal antibody, clone OTI8C8 (formerly 8C8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C8FW; GIG-2; GIG2; SKIP1; TRB-1; TRB1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282985, the custom clone sequence may differ by one or more nucleotides


ATGCACTCCTATGTGCGAAGCCGGAAGAGGCTGCGGGAAGAGGAAGCCGCCCGGCTCTTCAAGCAGATTG
TCTCCGCCGTCGCCCACTGCCACCAGTCAGCCATCGTGCTGGGGGACCTGAAGCTTAGGAAGTTCGTCTT
CTCCACGGAGGAGAGAACCCAGCTTAGACTAGAAAGTCTAGAAGACACACACATAATGAAGGGGGAAGAT
GATGCTTTGTCAGACAAACATGGCTGCCCAGCCTACGTGAGCCCTGAGATCCTCAACACCACTGGGACCT
ACTCCGGAAAGGCTGCGGACGTTTGGAGCCTGGGGGTGATGCTCTACACCCTTCTGGTTGGACGATACCC
CTTCCATGACTCAGACCCCAGTGCCCTTTTCTCCAAAATTCGGCGTGGACAGTTCTGCATTCCTGAGCAC
ATTTCCCCCAAAGCCAGGTGCCTCATTCGCAGCCTCTTGAGACGGGAGCCCTCCGAGAGACTCACTGCCC
CCGAGATCCTACTGCACCCCTGGTTTGAGTCCGTCTTGGAACCCGGGTACATCGACTCAGAAATAGGAAC
TTCAGACCAGATTGTTCCAGAGTACCAGGAGGACAGTGACATTAGTTCCTTCTTCTGCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001282985
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282985.1, NP_001269914.1
RefSeq Size 2823 bp
RefSeq ORF 621 bp
Locus ID 10221
UniProt ID Q96RU8
Protein Families Druggable Genome, Protein Kinase
Gene Summary Adapter protein involved in protein degradation by interacting with COP1 ubiquitin ligase (PubMed:27041596). The COP1-binding motif is masked by autoinhibitory interactions with the protein kinase domain (PubMed:26455797). Serves to alter COP1 substrate specificity by directing the activity of COP1 toward CEBPA (PubMed:27041596). Binds selectively the recognition sequence of CEBPA (PubMed:26455797). Regulates myeloid cell differentiation by altering the expression of CEBPA in a COP1-dependent manner (By similarity). Controls macrophage, eosinophil and neutrophil differentiation via the COP1-binding domain (By similarity). Interacts with MAPK kinases and regulates activation of MAP kinases, but has no kinase activity (PubMed:15299019, PubMed:26455797).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...