TRIB1 (NM_001282985) Human Untagged Clone
CAT#: SC334452
TRIB1 (untagged) - Human tribbles pseudokinase 1 (TRIB1), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
TRIB1 mouse monoclonal antibody, clone OTI8C8 (formerly 8C8)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C8FW; GIG-2; GIG2; SKIP1; TRB-1; TRB1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282985, the custom clone sequence may differ by one or more nucleotides
ATGCACTCCTATGTGCGAAGCCGGAAGAGGCTGCGGGAAGAGGAAGCCGCCCGGCTCTTCAAGCAGATTG TCTCCGCCGTCGCCCACTGCCACCAGTCAGCCATCGTGCTGGGGGACCTGAAGCTTAGGAAGTTCGTCTT CTCCACGGAGGAGAGAACCCAGCTTAGACTAGAAAGTCTAGAAGACACACACATAATGAAGGGGGAAGAT GATGCTTTGTCAGACAAACATGGCTGCCCAGCCTACGTGAGCCCTGAGATCCTCAACACCACTGGGACCT ACTCCGGAAAGGCTGCGGACGTTTGGAGCCTGGGGGTGATGCTCTACACCCTTCTGGTTGGACGATACCC CTTCCATGACTCAGACCCCAGTGCCCTTTTCTCCAAAATTCGGCGTGGACAGTTCTGCATTCCTGAGCAC ATTTCCCCCAAAGCCAGGTGCCTCATTCGCAGCCTCTTGAGACGGGAGCCCTCCGAGAGACTCACTGCCC CCGAGATCCTACTGCACCCCTGGTTTGAGTCCGTCTTGGAACCCGGGTACATCGACTCAGAAATAGGAAC TTCAGACCAGATTGTTCCAGAGTACCAGGAGGACAGTGACATTAGTTCCTTCTTCTGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282985 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282985.1, NP_001269914.1 |
RefSeq Size | 2823 bp |
RefSeq ORF | 621 bp |
Locus ID | 10221 |
UniProt ID | Q96RU8 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | Adapter protein involved in protein degradation by interacting with COP1 ubiquitin ligase (PubMed:27041596). The COP1-binding motif is masked by autoinhibitory interactions with the protein kinase domain (PubMed:26455797). Serves to alter COP1 substrate specificity by directing the activity of COP1 toward CEBPA (PubMed:27041596). Binds selectively the recognition sequence of CEBPA (PubMed:26455797). Regulates myeloid cell differentiation by altering the expression of CEBPA in a COP1-dependent manner (By similarity). Controls macrophage, eosinophil and neutrophil differentiation via the COP1-binding domain (By similarity). Interacts with MAPK kinases and regulates activation of MAP kinases, but has no kinase activity (PubMed:15299019, PubMed:26455797).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...