FRA1 (FOSL1) (NM_001300856) Human Untagged Clone
CAT#: SC334447
FOSL1 (untagged) - Human FOS-like antigen 1 (FOSL1), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Anti-FOSL1 (FRA1) mouse monoclonal antibody, clone OTI12F9 (formerly 12F9)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FRA; fra-1; FRA1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300856, the custom clone sequence may differ by one or more nucleotides
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGC CCCCGGCCGCAGCGCAGGCAGCCCAGCAGATCAGCCCGGAGGAAGAGGAGCGCCGCCGAGTAAGGCGCGA GCGGAACAAGCTGGCTGCGGCCAAGTGCAGGAACCGGAGGAAGGAACTGACCGACTTCCTGCAGGCGGAG ACTGACAAACTGGAAGATGAGAAATCTGGGCTGCAGCGAGAGATTGAGGAGCTGCAGAAGCAGAAGGAGC GCCTAGAGCTGGTGCTGGAAGCCCACCGACCCATCTGCAAAATCCCGGAAGGAGCCAAGGAGGGGGACAC AGGCAGTACCAGTGGCACCAGCAGCCCACCAGCCCCCTGCCGCCCTGTACCTTGTATCTCCCTTTCCCCA GGGCCTGTGCTTGAACCTGAGGCACTGCACACCCCCACACTCATGACCACACCCTCCCTAACTCCTTTCA CCCCCAGCCTGGTCTTCACCTACCCCAGCACTCCTGAGCCTTGTGCCTCAGCTCATCGCAAGAGTAGCAG CAGCAGCGGAGACCCATCCTCTGACCCCCTTGGCTCTCCAACCCTCCTCGCTTTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300856 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001300856.1, NP_001287785.1 |
RefSeq Size | 1561 bp |
RefSeq ORF | 618 bp |
Locus ID | 8061 |
UniProt ID | P15407 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Wnt signaling pathway |
Gene Summary | The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (4) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (4) has the same N- and C-termini but is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...