SNAP-beta (NAPB) (NM_001283026) Human Untagged Clone
CAT#: SC334439
NAPB (untagged) - Human N-ethylmaleimide-sensitive factor attachment protein, beta (NAPB), transcript variant 4
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SNAP-BETA; SNAPB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001283026, the custom clone sequence may differ by one or more nucleotides
ATGACTCTGCTACCAGCTTTGTGGATGCTGGAAATGCTTACAAAAAGGCAGATCCCCAAGGGAAGGTTTA CAATTGCAGCCAAGCACCACATTACTATTGCAGAGATCTATGAGACTGAACTTGTAGACATTGAGAAGGC TATTGCACATTATGAACAATCTGCTGATTATTACAAAGGAGAAGAATCCAACAGCTCAGCAAACAAGTGT CTGCTGAAGGTGGCAGCATATGCTGCCCAGCTTGAGCAGTACCAGAAAGCCATTGAGATCTATGAGCAGG TTGGGGCAAACACAATGGATAATCCTTTGTTGAAATACAGTGCAAAGGATTACTTCTTCAAAGCTGCCCT CTGCCACTTCATAGTAGACGAGTTGAATGCCAAGCTTGCTCTTGAGAAATATGAGGAAATGTTTCCAGCA TTTACTGATTCAAGAGAATGTAAATTATTGAAAAAACTCCTAGAAGCTCATGAAGAACAGAACAGTGAAG CTTACACTGAAGCAGTGAAGGAATTTGACTCAATATCTCGCTTGGATCAGTGGCTGACCACCATGTTGCT TCGCATCAAAAAGTCCATCCAAGGGGATGGAGAAGGAGATGGAGACCTAAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001283026 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001283026.1, NP_001269955.1 |
RefSeq Size | 3824 bp |
RefSeq ORF | 615 bp |
Locus ID | 63908 |
UniProt ID | Q9H115 |
Gene Summary | This gene encodes a member of the soluble N-ethyl-maleimide-sensitive fusion attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. This gene encodes the SNAP beta isoform which has been shown to be preferentially expressed in brain tissue. The encoded protein also interacts with the GluR2 α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor subunit C-terminus and may play a role as a chaperone in the molecular processing of the AMPA receptor. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (4) uses an alternate splice site and lacks an alternate exon in the 5' region, which results in the use of an alternate translational start codon, compared to variant 1. The encoded isoform (d) has a distinct N-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236545 | NAPB (myc-DDK-tagged) - Human N-ethylmaleimide-sensitive factor attachment protein, beta (NAPB), transcript variant 4 |
CNY 3,990.00 |
|
RG236545 | NAPB (tGFP-tagged) - Human N-ethylmaleimide-sensitive factor attachment protein, beta (NAPB), transcript variant 4 |
CNY 4,370.00 |