SNAP-beta (NAPB) (NM_001283026) Human Untagged Clone

CAT#: SC334439

NAPB (untagged) - Human N-ethylmaleimide-sensitive factor attachment protein, beta (NAPB), transcript variant 4



  "NM_001283026" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-NAPB Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SNAP-BETA; SNAPB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001283026, the custom clone sequence may differ by one or more nucleotides


ATGACTCTGCTACCAGCTTTGTGGATGCTGGAAATGCTTACAAAAAGGCAGATCCCCAAGGGAAGGTTTA
CAATTGCAGCCAAGCACCACATTACTATTGCAGAGATCTATGAGACTGAACTTGTAGACATTGAGAAGGC
TATTGCACATTATGAACAATCTGCTGATTATTACAAAGGAGAAGAATCCAACAGCTCAGCAAACAAGTGT
CTGCTGAAGGTGGCAGCATATGCTGCCCAGCTTGAGCAGTACCAGAAAGCCATTGAGATCTATGAGCAGG
TTGGGGCAAACACAATGGATAATCCTTTGTTGAAATACAGTGCAAAGGATTACTTCTTCAAAGCTGCCCT
CTGCCACTTCATAGTAGACGAGTTGAATGCCAAGCTTGCTCTTGAGAAATATGAGGAAATGTTTCCAGCA
TTTACTGATTCAAGAGAATGTAAATTATTGAAAAAACTCCTAGAAGCTCATGAAGAACAGAACAGTGAAG
CTTACACTGAAGCAGTGAAGGAATTTGACTCAATATCTCGCTTGGATCAGTGGCTGACCACCATGTTGCT
TCGCATCAAAAAGTCCATCCAAGGGGATGGAGAAGGAGATGGAGACCTAAAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001283026
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001283026.1, NP_001269955.1
RefSeq Size 3824 bp
RefSeq ORF 615 bp
Locus ID 63908
UniProt ID Q9H115
Gene Summary This gene encodes a member of the soluble N-ethyl-maleimide-sensitive fusion attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. This gene encodes the SNAP beta isoform which has been shown to be preferentially expressed in brain tissue. The encoded protein also interacts with the GluR2 α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor subunit C-terminus and may play a role as a chaperone in the molecular processing of the AMPA receptor. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (4) uses an alternate splice site and lacks an alternate exon in the 5' region, which results in the use of an alternate translational start codon, compared to variant 1. The encoded isoform (d) has a distinct N-terminus and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...