YL1 (VPS72) (NM_001271088) Human Untagged Clone
CAT#: SC334400
VPS72 (untagged) - Human vacuolar protein sorting 72 homolog (S. cerevisiae) (VPS72), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CFL1; Swc2; TCFL1; YL-1; YL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001271088, the custom clone sequence may differ by one or more nucleotides
ATGAGTTTGGCTGGGGGCCGGGCACCCCGGAAGACCGCTGGGAACCGGCTTTCTGGGCTTTTGGAGGCAG AGGAGGAAGATGAGTTCTACCAGACGACTTATGGGGGTTTCACAGAGGAATCCGGAGATGATGAGTATCA AGGGGACCAGTCAGACACAGAGGACGAAGTGGACTCTGACTTTGACATTGATGAAGGGGATGAACCATCC AGTGATGGAGAAGCAGAAGAGCCAAGAAGGAAGCGCCGAGTAGTCACCAAGGCCTATAAGGAACCTCTCA AGAGCTTAAGGCCTCGAAAGGTCAACACCCCGGCTGGTAGCTCTCAGAAGGCGCGAGAAGAGAAGGCACT ACTGCCATTAGAACTACAAGATGACGGCTCTGACAGTCGGAAGTCTATGCGTCAGTCTACAGCTGAGCAT ACACGACAAACGTTCCTTCGGGTACAGGAGAGGCAGGGCCAGTCAAGACGGCGAAAGGGGCCCCACTGTG AGCGGCCACTAACCCAGGAGGAACTGCTCCGGGAGGCCAAGATCACAGAAGAGCTTAATTTACGGTCACT GGAGACATATGAGGCGGCCCCCAAAAGTCCCTGTTCGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271088 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271088.1, NP_001258017.1 |
RefSeq Size | 1262 bp |
RefSeq ORF | 600 bp |
Locus ID | 6944 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. The TRRAP/TIP60 complex acetylates nucleosomal histones important for transcriptional regulation, double strand DNA break repair and apoptosis. The SRCAP-containing complex catalyzes the exchange of histone H2A with the histone variant Htz1 (H2AFZ) into nucleosomes. This protein may be responsible for binding H2AFZ, which has a role in chromosome segregation. This protein may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (3) uses two alternate splice sites in the 3' coding region that result in a frameshift, compared to variant 1. The resulting protein (isoform 3) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. COMPLETENESS: complete on the 3' end. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...