GGT6 (NM_001288703) Human Untagged Clone

CAT#: SC334393

GGT6 (untagged) - Human gamma-glutamyltransferase 6 (GGT6), transcript variant 4



  "NM_001288703" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288703, the custom clone sequence may differ by one or more nucleotides


ATGGAGCGGGCAGAAGAGCCCGTGGTCTATCAGAAGCTGCTGCCCTGGGAGCCAAGCTTGGAGTCGGAGG
AGGAAGTGGAGGAGGAGGAGACATCAGAGGCGCTGGTTCTAAACCCCCGGAGGCACCAGGACTCTTCCAG
GAACAAGGCTGGCGGGCTGCCCGGAACCTGGGCCCGTGTAGTGGCAGCCCTGCTGCTGCTGGCTGTTGGC
TGCTCCCTGGCTGTGAGGCAGCTCCAGAATCAGGGCAGGTCGACAGGAAGCTTGGGCTCTGTGGCCCCTC
CACCCGGCGGACACTCCCACGGCCCTGGCGTATACCACCACGGTGCCATCATCAGCCCTGCAGGCCGAGA
GCTGCTTGTTGCCGGGGGCAACGTCGTGGATGCTGGAGTTGGAGCTGCATTGTGCCTGGCAGTGGTGCAT
CCTCATGCCACGGGGCTAGACTGCTGTGAGCCCCGAGAGCAGTGCCCTGGCCGCCGTGGACAGCAGCGGC
TCTGTGCTCCTTCTCACCTCCTCGCTCAACTGCTCCTTTGGCTCTGCACACCTGTCCCCAAGCACTGGGG
TTCTGCTCAGCAACCTGGTGGCCAAGTCTACCACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001288703
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288703.1, NP_001275632.1
RefSeq Size 2062 bp
RefSeq ORF 597 bp
Locus ID 124975
UniProt ID Q6P531
Protein Pathways Arachidonic acid metabolism, Cyanoamino acid metabolism, Glutathione metabolism, Metabolic pathways, Selenoamino acid metabolism, Taurine and hypotaurine metabolism
Gene Summary GGT6 belongs to the gamma-glutamyltransferase (GGT; EC 2.3.2.2) gene family. GGT is a membrane-bound extracellular enzyme that cleaves gamma-glutamyl peptide bonds in glutathione and other peptides and transfers the gamma-glutamyl moiety to acceptors. GGT is also key to glutathione homeostasis because it provides substrates for glutathione synthesis (Heisterkamp et al., 2008 [PubMed 18357469]).[supplied by OMIM, Oct 2008]
Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 5' coding region and another alternate splice site in the 3' coding region, the latter resulting in a frameshift and an early stop codon, compared to variant 3. It encodes isoform d, which is shorter and has a distinct C-terminus, compared to isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...