RHOH (NM_001278366) Human Untagged Clone

CAT#: SC334338

RHOH (untagged) - Human ras homolog family member H (RHOH), transcript variant 9



  "NM_001278366" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RHOH mouse monoclonal antibody,clone OTI9F4
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARHH; TTF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278366, the custom clone sequence may differ by one or more nucleotides


ATGCTGAGTTCCATCAAGTGCGTGTTGGTGGGCGACTCTGCTGTGGGGAAAACCTCTCTGTTGGTGCGCT
TCACCTCCGAGACCTTCCCGGAGGCCTACAAGCCCACAGTGTACGAGAACACAGGGGTGGACGTCTTCAT
GGATGGCATCCAGATCAGCCTGGGCCTCTGGGACACAGCCGGCAATGACGCCTTCAGAAGCATCCGGCCC
CTGTCCTACCAGCAGGCAGACGTGGTGCTGATGTGCTACTCTGTGGCCAACCATAACTCATTCCTGAACT
TGAAGAACAAGTGGATTGGTGAAATTAGGAGCAACTTGCCCTGTACCCCTGTGCTGGTGGTGGCCACCCA
GACTGACCAGCGGGAGATGGGGCCCCACAGGGCCTCCTGCGTCAATGCCATGGAAGGGAAGAAACTGGCC
CAGGATGTCAGAGCCAAGGGCTACCTGGAGTGCTCAGCCCTTAGCAATCGGGGAGTACAGCAGGTGTTTG
AGTGCGCCGTCCGAACTGCCGTCAACCAGGCCAGGAGACGAAACAGAAGGAGGCTCTTCTCCATCAATGA
GTGCAAGATCTTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001278366
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278366.1, NP_001265295.1
RefSeq Size 2045 bp
RefSeq ORF 576 bp
Locus ID 399
UniProt ID Q15669
Protein Families Transcription Factors
Protein Pathways Leukocyte transendothelial migration
Gene Summary The protein encoded by this gene is a member of the Ras superfamily of guanosine triphosphate (GTP)-metabolizing enzymes. The encoded protein is expressed in hematopoietic cells, where it functions as a negative regulator of cell growth and survival. This gene may be hypermutated or misexpressed in leukemias and lymphomas. Chromosomal translocations in non-Hodgkin's lymphoma occur between this locus and B-cell CLL/lymphoma 6 (BCL6) on chromosome 3, leading to the production of fusion transcripts. Alternative splicing in the 5' untranslated region results in multiple transcript variants that encode the same protein. [provided by RefSeq, May 2013]
Transcript Variant: This variant (9) differs in the 5' most exons and lacks an exon in the 5' UTR, compared to variant 1. Variants 1 through 12 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...