NADE (BEX3) (NM_001282674) Human Untagged Clone
CAT#: SC334327
NGFRAP1 (untagged) - Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 4
CN¥ 2,950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Bex; DXS6984E; HGR74; NADE; NGFRAP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282674, the custom clone sequence may differ by one or more nucleotides
ATGGCGGTGGCGGGTGGGGGGAAGGGGGAGATCCTGCTGCACTGGCCGCCCAAGTTGGGGGGCGAGCTCG GTGGTGACGCGCGGCCCTCACGTGACCCAGAGCTGCAGAGCGACGCAGCCTTCGGTGCAGTCGTCACTCG CGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATTCGGCCCGGGGAAAAGCGGAGCA GAAAAACAACCAGAAAAAAAAAATCTCATCATGGCAAATATTCACCAGGAAAACGAAGAGATGGAGCAGC CTATGCAGAATGGAGAGGAAGACCGCCCTTTGGGAGGAGGTGAAGGCCACCAGCCTGCAGGAAATCGACG GGGACAGGCTCGCCGACTTGCCCCTAATTTTCGATGGGCCATACCCAATAGGCAGATCAATGATGGGATG GGTGGAGATGGAGATGATATGGAAATATTCATGGAGGAGATGAGAGAAATCAGAAGAAAACTTAGGGAGC TGCAGTTGAGGAATTGTCTGCGTATCCTTATGGGGGAGCTCTCTAATCACCATGACCATCATGATGAATT TTGCCTTATGCCTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282674 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282674.1, NP_001269603.1 |
RefSeq Size | 993 bp |
RefSeq ORF | 576 bp |
Locus ID | 27018 |
Protein Families | Druggable Genome |
Protein Pathways | Neurotrophin signaling pathway |
Gene Summary | May be a signaling adapter molecule involved in p75NTR-mediated apoptosis induced by NGF. Plays a role in zinc-triggered neuronal death (By similarity). May play an important role in the pathogenesis of neurogenetic diseases.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks an exon, uses an alternate internal splice site, and initiates translation at an alternate upstream start codon, compared to variant 1. The encoded isoform (c) has a longer N-terminus than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236433 | NGFRAP1 (myc-DDK-tagged) - Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 4 |
CN¥ 3,990.00 |
|
RG236433 | NGFRAP1 (tGFP-tagged) - Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 4 |
CN¥ 4,370.00 |