SLAMF7 (NM_001282591) Human Untagged Clone

CAT#: SC334303

SLAMF7 (untagged) - Human SLAM family member 7 (SLAMF7), transcript variant 5



  "NM_001282591" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SLAMF7 mouse monoclonal antibody, clone OTI3B3 (formerly 3B3)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 19A; CD319; CRACC; CS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282591, the custom clone sequence may differ by one or more nucleotides


ATGGCTGGTTCCCCAACATGCCTCACCCTCATCTATATCCTTTGGCAGCTCACAGAGCACCTGTCAAAGC
CTAAAGTCACCATGGGTCTGCAGAGCAATAAGAATGGCACCTGTGTGACCAATCTGACATGCTGCATGGA
ACATGGGGAAGAGGATGTGATTTATACCTGGAAGGCCCTGGGGCAAGCAGCCAATGAGTCCCATAATGGG
TCCATCCTCCCCATCTCCTGGAGATGGGGAGAAAGTGATATGACCTTCATCTGCGTTGCCAGGAACCCTG
TCAGCAGAAACTTCTCAAGCCCCATCCTTGCCAGGAAGCTCTGTGAAGAGTACATTGAAGAGAAGAAGAG
AGTGGACATTTGTCGGGAAACTCCTAACATATGCCCCCATTCTGGAGAGAACACAGAGTACGACACAATC
CCTCACACTAATAGAACAATCCTAAAGGAAGATCCAGCAAATACGGTTTACTCCACTGTGGAAATACCGA
AAAAGATGGAAAATCCCCACTCACTGCTCACGATGCCAGACACACCAAGGCTATTTGCCTATGAGAATGT
TATCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001282591
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282591.1, NP_001269520.1
RefSeq Size 2467 bp
RefSeq ORF 567 bp
Locus ID 57823
UniProt ID Q9NQ25
Protein Families Druggable Genome, Transmembrane
Gene Summary Self-ligand receptor of the signaling lymphocytic activation molecule (SLAM) family. SLAM receptors triggered by homo- or heterotypic cell-cell interactions are modulating the activation and differentiation of a wide variety of immune cells and thus are involved in the regulation and interconnection of both innate and adaptive immune response. Activities are controlled by presence or absence of small cytoplasmic adapter proteins, SH2D1A/SAP and/or SH2D1B/EAT-2. Isoform 1 mediates NK cell activation through a SH2D1A-independent extracellular signal-regulated ERK-mediated pathway (PubMed:11698418). Positively regulates NK cell functions by a mechanism dependent on phosphorylated SH2D1B. Downstream signaling implicates PLCG1, PLCG2 and PI3K (PubMed:16339536). In addition to heterotypic NK cells-target cells interactions also homotypic interactions between NK cells may contribute to activation. However, in the absence of SH2D1B, inhibits NK cell function. Acts also inhibitory in T-cells (By similarity). May play a role in lymphocyte adhesion (PubMed:11802771). In LPS-activated monocytes negatively regulates production of proinflammatory cytokines (PubMed:23695528).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) lacks an alternate in-frame exon in both the 5' and central coding regions, compared to variant 1, resulting in an isoform (e) that is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...