METTL23 (NM_001302705) Human Untagged Clone

CAT#: SC334289

METTL23 (untagged) - Human methyltransferase like 23 (METTL23), transcript variant 10



  "NM_001302705" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C17orf95; MRT44
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302705, the custom clone sequence may differ by one or more nucleotides


ATGGAATGTATGTTTGGCCCTGTGCTGTGGTCCTGGCCCAGTACCTTTGGTTTCACAGAAGATCTCTGCC
AGATTGGAGCTGGAGTGAGCCTTCCAGGAATTTTGGCTGCCAAATGTGGTGCAGAAGTAATACTGTCAGA
CAGCTCAGAACTGCCTCACTGTCTGGAAGTCTGTCGGCAAAGCTGCCAAATGAATAACCTGCCACATCTG
CAGGTGGTAGGACTAACATGGGGTCATATATCTTGGGATCTTCTGGCTCTACCACCACAAGATATTATCC
TTGCATCTGATGTGTTCTTTGAACCAGAAGATTTTGAAGACATTTTGGCTACAATATATTTTTTGATGCA
CAAGAATCCCAAGGTCCAATTGTGGTCTACTTATCAAGTTAGGAGTGCTGACTGGTCACTTGAAGCTTTA
CTCTACAAATGGGATATGAAATGTGTCCACATTCCTCTTGAGTCTTTTGATGCAGACAAAGAAGATATAG
CAGAATCTACCCTTCCAGGAAGACATACAGTTGAAATGCTGGTCATTTCCTTTGCAAAGGACAGTCTCTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001302705
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302705.1, NP_001289634.1
RefSeq Size 836 bp
RefSeq ORF 561 bp
Locus ID 124512
UniProt ID Q86XA0
Gene Summary The protein encoded by this gene functions as a transcription factor regulator in the transcriptional pathway for human cognition. It is a partner of the alpha subunit of the GA-binding protein transcription factor. Mutations in this gene cause mild autosomal recessive intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (10) uses an alternate splice site in both the 5' UTR and 5' coding region, and it thus differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...