DIABLO (NM_001278304) Human Untagged Clone
CAT#: SC334276
DIABLO (untagged) - Human diablo, IAP-binding mitochondrial protein (DIABLO), transcript variant 7
CNY 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DFNA64; SMAC |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001278304, the custom clone sequence may differ by one or more nucleotides
ATGAAATCTGACTTCTACTTCCAGAAATCAGAGCCTCATTCCCTTAGTAGTGAAGCATTGATGAGGAGAG CAGTGTCTTTGGTAACAGATAGCACCTCTACCTTTCTCTCTCAGACCACATATGCGTTGATTGAAGCTAT TACTGAATATACTAAGGCTGTTTATACCTTAACTTCTCTTTACCGACAATATACAAGTTTACTTGGGAAA ATGAATTCAGAGGAGGAAGATGAAGTGTGGCAGGTGATCATAGGAGCCAGAGCTGAGATGACTTCAAAAC ACCAAGAGTACTTGAAGCTGGAAACCACTTGGATGACTGCAGTTGGTCTTTCAGAGATGGCAGCAGAAGC TGCATATCAAACTGGCGCAGATCAGGCCTCTATAACCGCCAGGAATCACATTCAGCTGGTGAAACTGCAG GTGGAAGAGGTGCACCAGCTCTCCCGGAAAGCAGAAACCAAGCTGGCAGAAGCACAGATAGAAGAGCTCC GTCAGAAAACACAGGAGGAAGGGGAGGAGCGGGCTGAGTCGGAGCAGGAGGCCTACCTGCGTGAGGATTG A |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278304 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278304.1, NP_001265233.1 |
RefSeq Size | 2483 bp |
RefSeq ORF | 561 bp |
Locus ID | 56616 |
UniProt ID | Q9NR28 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013] Transcript Variant: This variant (7) differs in its 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The encoded isoform (2, also known as Smac-beta and Smac/DIABLO-S) has a shorter and distinct N-terminus, compared to isoform 1. Isoform 2 has a cortical, instead of a mitochondrial, subcellular distribution, and lacks the inhibitor of apoptosis protein-binding domain but maintains the ability to potentiate apoptosis (PMID: 11285287). Variants 2 and 7 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...