D4S234E (NSG1) (NM_001287763) Human Untagged Clone
CAT#: SC334267
NSG1 (untagged) - Human neuron specific gene family member 1 (NSG1), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D4S234; D4S234E; NEEP21; P21 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001287763, the custom clone sequence may differ by one or more nucleotides
ATGGTGAAGTTGGGGAACAATTTCGCAGAGAAGGGCACCAAGCAGCCGCTGCTGGAGGATGGCTTCGACA CCATTCCCCTGATGACGCCCCTCGATGTCAATCAGCTGCAGTTCCCGCCCCCGGATAAGGTGGTCGTGAA AACTAAGACCGAGTATGAACCTGACCGCAAGAAAGGGAAAGCACGTCCTCCCCAAATTGCTGAGTTCACC GTCAGCATCACGGAGGGTGTCACCGAGAGGTTTAAGGTCTCCGTGTTGGTCCTCTTCGCCCTGGCCTTCC TCACCTGCGTCGTCTTCCTGGTTGTCTACAAGGTGTACAAGTATGACCGCGCCTGCCCCGATGGGTTCGT CCTCAAGAACACCCAGTGCATCCCAGAAGGCTTGGAGAGCTACTACGCGGAGCAAGACTCCAGTGCCCGG GAGAAATTTTACACAGTCATAAACCACTACAACCTGGCCAAGCAGAGCATCACGCGCTCCGTATCGCCCT GGATGTCAGTTCTGTCAGAAGAGAAGCTGTCCGAGCAGGAGACTGAAGCGGCTGAGAAGTCAGCTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287763 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001287763.1, NP_001274692.1 |
RefSeq Size | 2650 bp |
RefSeq ORF | 558 bp |
Locus ID | 27065 |
UniProt ID | P42857 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | Plays a role in the recycling mechanism in neurons of multiple receptors, including AMPAR, APP and L1CAM and acts at the level of early endosomes to promote sorting of receptors toward a recycling pathway. Regulates sorting and recycling of GRIA2 through interaction with GRIP1 and then contributes to the regulation of synaptic transmission and plasticity by affecting the recycling and targeting of AMPA receptors to the synapse (By similarity). Is required for faithful sorting of L1CAM to axons by facilitating trafficking from somatodendritic early endosome or the recycling endosome (By similarity). In an other hand, induces apoptosis via the activation of CASP3 in response to DNA damage (PubMed:20599942, PubMed:20878061).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) represents the longest transcript and encodes the longer isoform (a). Variants 1, 2, and 3 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...