Granzyme H (GZMH) (NM_001270780) Human Untagged Clone

CAT#: SC334244

GZMH (untagged) - Human granzyme H (cathepsin G-like 2, protein h-CCPX) (GZMH), transcript variant 2



  "NM_001270780" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GZMH rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CCP-X; CGL-2; CSP-C; CTLA1; CTSGL2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001270780, the custom clone sequence may differ by one or more nucleotides


ATGCAGCCATTCCTCCTCCTGTTGGCCTTTCTTCTGACCCCTGGGGCTGGGACAGAGGAGATCATCGGGG
GCCATGAGGCCAAGCCCCACTCCCGCCCCTACATGGCCTTTGTTCAGTTTCTGCAAGAGAAGAGTCGGAA
GAGGTGTGGCGGCATCCTAGTGAGAAAGGACTTTGTGCTGACAGCTGCTCACTGCCAGGGAAGCTCCATA
AATGTCACCTTGGGGGCCCACAATATCAAGGAACAGGAGCGGACCCAGCAGTTTATCCCTGTGAAAAGAC
CCATCCCCCATCCAGCCTATAATCCTAAGAACTTCTCCAACGACATCATGCTACTGCAGCTGGAGAGAAA
GGCCAAGTGGACCACAGCTGTGCGGCCTCTCAGGCTACCTAGCAGCAAGGCCCAGGGGGACTCCGGGGGG
CCCCTCGTGTGTAAGGACGTAGCCCAAGGTATTCTCTCCTATGGAAACAAAAAAGGGACACCTCCAGGAG
TCTACATCAAGGTCTCACACTTCCTGCCCTGGATAAAGAGAACAATGAAGCGCCTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001270780
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270780.1, NP_001257709.1
RefSeq Size 795 bp
RefSeq ORF 549 bp
Locus ID 2999
Protein Families Druggable Genome, Protease
Gene Summary This gene encodes a member of the peptidase S1 family of serine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a chymotrypsin-like protease. This protein is reported to be constitutively expressed in the NK (natural killer) cells of the immune system and may play a role in the cytotoxic arm of the innate immune response by inducing target cell death and by directly cleaving substrates in pathogen-infected cells. This gene is present in a gene cluster with another member of the granzyme subfamily on chromosome 14. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region compared to variant 1. It encodes isoform 2 which is shorter than isoform 1. This isoform (2) may undergo proteolytic processing similar to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...