CDCA3 (NM_001297604) Human Untagged Clone

CAT#: SC334241

CDCA3 (untagged) - Human cell division cycle associated 3 (CDCA3), transcript variant 4



  "NM_001297604" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CDCA3 mouse monoclonal antibody,clone OTI6F7
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GRCC8; TOME-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001297604, the custom clone sequence may differ by one or more nucleotides


ATGGGCTCAGCCAAGAGCGTCCCAGTCACACCAGCGCGGCCTCCGCCGCACAACAAGCATCTGGCTCGAG
TGGCGGACCCCCGTTCACCTAGTGCTGGCATCCTGCGCACTCCCATCCAGGTGGAGAGCTCTCCACAGCC
AGGCCTACCAGCAGGGGAGCAACTGGAGGGTCTTAAACATGCCCAGGACTCAGATCCCCGCTCTCCTACT
CTTGGTATTGCACGGACACCTATGAAGACCAGCAGTGGAGACCCCCCAAGCCCACTGGTGAAACAGCTGA
GTGAAGTATTTGAAACTGAAGACTCTAAATCAAATCTTCCCCCAGAGCCTGTTCTGCCCCCAGAGGCACC
TTTATCTTCTGAATTGGACTTGCCTCTGGGTACCCAGTTATCTGTTGAGGAACAGATGCCACCTTGGAAC
CAGACTGAGTTCCCCTCCAAACAGGTGTTTTCCAAGGAGGAAGCAAGACAGCCCACAGAAACCCCTGTGG
CCAGCCAGAGCTCCGACAAGCCCTCAAGGGACCCTGAGACTCCCAGATCTTCAGGGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001297604
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297604.1, NP_001284533.1
RefSeq Size 1837 bp
RefSeq ORF 549 bp
Locus ID 83461
UniProt ID Q99618
Gene Summary F-box-like protein which is required for entry into mitosis. Acts by participating in E3 ligase complexes that mediate the ubiquitination and degradation of WEE1 kinase at G2/M phase (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks an alternate exon in the 3' coding region, resulting in a frameshift compared to variant 1. The encoded isoform (4) has a distinct C-terminus, and is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...