BTD (NM_001281726) Human Untagged Clone

CAT#: SC334208

BTD (untagged) - Human biotinidase (BTD), transcript variant 5



  "NM_001281726" in other vectors (2)

CN¥ 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
BTD Rabbit polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281726, the custom clone sequence may differ by one or more nucleotides


ATGGCGCATGCGCATATTCAGGGCGGAAGGCGCGCTAAGAGCAGATTTGTGGTCTGCATTATGTCTGGAG
CCAGAAGTAAGCTTGCTCTTTTCCTCTGCGGCTGTTACGTGGTTGCCCTGGGAGCCCACACCGGGGAGGA
GAGCGTGGCTGACCATCACGAGGCTGAATATTATGTGGCTGCCGTGTATGAGCATCCATCCATCCTGAGT
CTGAACCCTCTGGCTCTCATCAGCCGCCAAGAGGCCTTGGAGCTCATGAACCAGAACCTTGACATCTATG
AACAGCAAGTGATGACTGCAGCCCAAAAGGATGTACAGATTATAGTGTTTCCAGAAGATGGCATTCATGG
ATTCAACTTTACAAGAACATCCATTTATCCATTTTTGGACTTCATGCCGTCTCCCCAGGTGGTCAGGTGG
AACCCATGCCTGGAGCCTCACCGCTTCAATGACACAGAGGTGATTCCTGCCTTTTTCCTCAGTAGGCTGA
GGGTACACAGAGGTGATCTAAGTCAGGGACCAGAAGCTGTGACATGTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001281726
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001281726.1, NP_001268655.1
RefSeq Size 769 bp
RefSeq ORF 540 bp
Locus ID 686
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Biotin metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene functions to recycle protein-bound biotin by cleaving biocytin (biotin-epsilon-lysine), a normal product of carboxylase degradation, resulting in regeneration of free biotin. The encoded protein has also been shown to have biotinyl transferase activity. Mutations in this gene are associated with biotinidase deficiency. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (5) has multiple differences compared to variant 1, one of which results in a translational frameshift. The resulting protein (isoform 5) is shorter and has distinct N- and C-termini compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...