TMED4 (NM_001303059) Human Untagged Clone
CAT#: SC334203
TMED4 (untagged) - Human transmembrane emp24 protein transport domain containing 4 (TMED4), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ERS25; GMP25iso; HNLF; p24a3; p24alpha3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001303059, the custom clone sequence may differ by one or more nucleotides
ATGGCAGGTGTCGGGGCTGGGCCTCTGCGGGCGATGGGGCGGCAGGCCCTGCTGCTTCTCGCGCTGTGCG CCACAGGCGCCCAGGGGCTCTACTTCCACATCGGCGAGACCGAGAAGCGCTGTTTCATCGAGGAAATCCC CGACGAGACCATGGTCATCGGCAACTATCGTACCCAGATGTGGGATAAGCAGAAGGAGGTCTTCCTGCCC TCGACCCCTGGCCTGGGCATGCACGTGGAAGTGAAGGACCCCGACGGCAAGGTGGTGCTGTCCCGGCAGT ACGGCTCGGAGGGCCGCTTCACGTTCACCTCCCACACGCCCGGTGACCATCAAATCTGTCTGCACTCCAA TTCTACCAGGATGGCTCTCTTCGCTGGTGGCAAACTGTATCGTGAAGAGCGCTTCCGACTGACGAGCGAG AGCACCAACCAGAGGGTCCTATGGTGGTCCATTGCTCAGACTGTCATCCTCATCCTCACTGGCATCTGGC AGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303059 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001303059.1, NP_001289988.1 |
RefSeq Size | 2226 bp |
RefSeq ORF | 537 bp |
Locus ID | 222068 |
Protein Families | Transmembrane |
Gene Summary | Involved in vesicular protein trafficking, mainly in the early secretory pathway. targeting. Involved in the maintenance of the Golgi apparatus. Appears to play a role in the biosynthesis of secreted cargo including processing. Involved in endoplasmic reticulum stress response. May play a role in the regulation of heat-shock response and apoptosis (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an in-frame exon compared to variant 1. The encoded isoform (3) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236309 | TMED4 (myc-DDK-tagged) - Human transmembrane emp24 protein transport domain containing 4 (TMED4), transcript variant 3 |
CNY 3,990.00 |
|
RG236309 | TMED4 (tGFP-tagged) - Human transmembrane emp24 protein transport domain containing 4 (TMED4), transcript variant 3 |
CNY 4,370.00 |