p21 ARC (ARPC3) (NM_001287222) Human Untagged Clone
CAT#: SC334195
ARPC3 (untagged) - Human actin related protein 2/3 complex, subunit 3, 21kDa (ARPC3), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARC21; p21-Arc |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287222, the custom clone sequence may differ by one or more nucleotides
ATGCCGGCTTACCACTCTTCTCTCATGGATCCTGATACCAAACTCATCGGAAACATGGCACTGTTGCCTA TCAGAAGTCAATTCAAAGGACCTGCCCCCAGAGAGACAAAAGATACAGATATTGTGGATGAAGCCATCTA TTACTTCAAGGCCAATGTCTTCTTCAAAAACTATGAAATTAAGAATGAAGCTGATAGGACCTTGATATAT ATAACTCTCTACATTTCTGAATGTCTGAAGAAACTGCAAAAGTGCAATTCCAAAAGCCAAGGTGAGAAAG AAATGTATACGCTGGGAATCACTAATTTTCCCATTCCTGGAGAGCCTGGTTTTCCACTTAACGCAATTTA TGCCAAACCTGCAAACAAACAGGAAGATGTGATGAGAGCCTATTTACAACAGCTAAGGCAAGAGACTGGA CTGAGACTTTGTGAGAAAGTTTTCGACCCTCAGAATGATAAACCCAGCAAGTGGTGGACTTGCTTTGTGA AGAGACAGTTCATGAACAAGAGTCTTTCAGGACCTGGACAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287222 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001287222.1, NP_001274151.1 |
RefSeq Size | 959 bp |
RefSeq ORF | 534 bp |
Locus ID | 10094 |
UniProt ID | O15145 |
Protein Pathways | Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton |
Gene Summary | This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been conserved through evolution and is implicated in the control of actin polymerization in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013] Transcript Variant: This variant (2) uses an alternate in-frame acceptor splice site in the 3' coding region compared to variant 1. The resulting shorter isoform (2) lacks 1 aa compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
其它p21 ARC产品
Customer
Reviews
Loading...