POLR2H (NM_001278698) Human Untagged Clone
CAT#: SC334182
POLR2H (untagged) - Human polymerase (RNA) II (DNA directed) polypeptide H (POLR2H), transcript variant 1
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
POLR2H mouse monoclonal antibody,clone OTI4A12
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RPABC3; RPB8; RPB17 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278698, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGCATCCTGTTTGAGGATATTTTCGATGTGAAGGATATTGACCCGGAGGGCAAGAAGTTTGACC GAGTGTCTCGACTGCATTGTGAGAGTGAATCTTTCAAGATGGATCTAATCTTAGATGTAAACATTCAAAT TTACCCTGTAGACTTGGGTGACAAGTTTCGGTTGGTCATAGCTAGTACCTTGTATGAAGATGGTACCCTG GATGATGGTGAATACAACCCCACTGATGATAGGCCTTCCAGGGCTGACCAGTTTGAGTATGTAATGTATG GAAAAGTGTACAGGATTGAGGGAGATGAAACTTCTACTGAAGCAGCAACACGCCTGCTGAGATTGAGAGC TGCTGAGTGGCAGTGCTCCAGAATCACGGGATGGGGCCTTCTGTTTCAGCTCTGCGTACGTGTCCTATGG GGGCCTGCTCATGAGGCTGCAGGGGGATGCCAACAACCTGCATGGATTCGAGGTGGACTCCAGAGTTTAT CTCCTGATGAAGAAGCTAGCCTTCTGAACCTCGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278698 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278698.1, NP_001265627.1 |
RefSeq Size | 1328 bp |
RefSeq ORF | 528 bp |
Locus ID | 5437 |
UniProt ID | P52434 |
Protein Families | Transcription Factors |
Protein Pathways | Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase |
Gene Summary | The three eukaryotic RNA polymerases are complex multisubunit enzymes that play a central role in the transcription of nuclear genes. This gene encodes an essential and highly conserved subunit of RNA polymerase II that is shared by the other two eukaryotic DNA-directed RNA polymerases, I and III. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...