CBR1 (NM_001286789) Human Untagged Clone

CAT#: SC334170

CBR1 (untagged) - Human carbonyl reductase 1 (CBR1), transcript variant 2



  "NM_001286789" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CBR1 mouse monoclonal antibody,clone OTI4B4
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CBR; hCBR1; PG-9-KR; SDR21C1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286789, the custom clone sequence may differ by one or more nucleotides


ATGTCGTCCGGCATCCATGTAGCGCTGGTGACTGGAGGCAACAAGGGCATCGGCTTGGCCATCGTGCGCG
ACCTGTGCCGGCTGTTCTCGGGGGACGTGGTGCTCACGGCGCGGGACGTGACGCGGGGCCAGGCGGCCGT
ACAGCAGCTGCAGGCGGAGGGCCTGAGCCCGCGCTTCCACCAGCTGGACATCGACGATCTGCAGAGCATC
CGCGCCCTGCGCGACTTCCTGCGCAAGGAGTACGGGGGCCTGGACGTGCTGGTCAACAACGCGGGCATCG
CCTTCAAGGTTGCTGATCCCACACCCTTTCATATTCAAGCTGAAGTGACGATGAAAACAAATTTCTTTGG
TACCCGAGATGTGTGCACAGAATTACTCCCTCTAATAAAACCCCAAGCATCCTGCGTACTGTCTGCATGG
TCATGCCTCTCCCAAAATCCTTCAGGAGGAAAGTCCAAGCCCTTAGCATGGTTCACAGAGATGTCCATAA
TCTGCCGCTGCTTAACTCTGGGCCCATTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001286789
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286789.1, NP_001273718.1
RefSeq Size 1952 bp
RefSeq ORF 522 bp
Locus ID 873
UniProt ID P16152
Protein Families Druggable Genome
Protein Pathways Arachidonic acid metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene belongs to the short-chain dehydrogenases/reductases (SDR) family, which function as NADPH-dependent oxidoreductases having wide specificity for carbonyl compounds, such as quinones, prostaglandins, and various xenobiotics. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (2) uses an alternate acceptor splice site at the 3' terminal exon that causes a frame-shift compared to variant 1. The resulting shorter isoform (2) has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...