CBR1 (NM_001286789) Human Untagged Clone
CAT#: SC334170
CBR1 (untagged) - Human carbonyl reductase 1 (CBR1), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
CBR1 mouse monoclonal antibody,clone OTI4B4
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CBR; hCBR1; PG-9-KR; SDR21C1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286789, the custom clone sequence may differ by one or more nucleotides
ATGTCGTCCGGCATCCATGTAGCGCTGGTGACTGGAGGCAACAAGGGCATCGGCTTGGCCATCGTGCGCG ACCTGTGCCGGCTGTTCTCGGGGGACGTGGTGCTCACGGCGCGGGACGTGACGCGGGGCCAGGCGGCCGT ACAGCAGCTGCAGGCGGAGGGCCTGAGCCCGCGCTTCCACCAGCTGGACATCGACGATCTGCAGAGCATC CGCGCCCTGCGCGACTTCCTGCGCAAGGAGTACGGGGGCCTGGACGTGCTGGTCAACAACGCGGGCATCG CCTTCAAGGTTGCTGATCCCACACCCTTTCATATTCAAGCTGAAGTGACGATGAAAACAAATTTCTTTGG TACCCGAGATGTGTGCACAGAATTACTCCCTCTAATAAAACCCCAAGCATCCTGCGTACTGTCTGCATGG TCATGCCTCTCCCAAAATCCTTCAGGAGGAAAGTCCAAGCCCTTAGCATGGTTCACAGAGATGTCCATAA TCTGCCGCTGCTTAACTCTGGGCCCATTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286789 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286789.1, NP_001273718.1 |
RefSeq Size | 1952 bp |
RefSeq ORF | 522 bp |
Locus ID | 873 |
UniProt ID | P16152 |
Protein Families | Druggable Genome |
Protein Pathways | Arachidonic acid metabolism, Metabolic pathways |
Gene Summary | The protein encoded by this gene belongs to the short-chain dehydrogenases/reductases (SDR) family, which function as NADPH-dependent oxidoreductases having wide specificity for carbonyl compounds, such as quinones, prostaglandins, and various xenobiotics. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (2) uses an alternate acceptor splice site at the 3' terminal exon that causes a frame-shift compared to variant 1. The resulting shorter isoform (2) has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...