NME4 (NM_001286435) Human Untagged Clone
CAT#: SC334169
NME4 (untagged) - Human NME/NM23 nucleoside diphosphate kinase 4 (NME4), transcript variant 3
CN¥ 2,950.00
货期*
3周
规格
Product images

经常一起买 (4)
Anti-NME4 mouse monoclonal antibody, clone OTI1A5 (formerly 1A5)
CN¥ 1,999.00
CN¥ 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NDPK-D; nm23-H4; NM23H4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286435, the custom clone sequence may differ by one or more nucleotides
ATGGGCGGCCTCTTCTGGCGCTCCGCGCTGCGGGGGCTGCGCTGCGGCCCGCGGGCCCCGGGCCCGAGCC TGCTAGTGCGCCACGGCTCGGGAGGGCCCTCCTGGACCCGGGAGCGGACCCTGGTGGCGGTGAAGCCCGA TGGCGTGCAACGGCGGCTCGTTGGGGACGTGATCCAGCGCTTTGAGAGGCGGGGCTTCACGCTGGTGGGG ATGAAGATGCTGCAGGCACCAGAGAGCGTCCTTGCCGAGCACTACCAGGACCTGCGGAGGAAGCCCTTCT ACCCTGCCCTCATCCGCTACATGAGCTCTGGGCCTGTGGTGGCCATGGTCTGGGAAGGGTACAATGTCGT CCGCGCCTCGAGGGCCATGATTGGACACACCGACTCGGCTGAGGCTGCCCCAGGAACCATAAGGGGTGAC TTCAGCGTCCACATCAGCAGTCACAGGCTTGCTCCCCTAGACAGAGGGCAACGGGAGCAGCAGATGGTCC CTGGGATTCCTCAGGGTGCACATGAAGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286435 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286435.1, NP_001273364.1 |
RefSeq Size | 1169 bp |
RefSeq ORF | 522 bp |
Locus ID | 4833 |
UniProt ID | O00746 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Purine metabolism, Pyrimidine metabolism |
Gene Summary | The nucleoside diphosphate (NDP) kinases (EC 2.7.4.6) are ubiquitous enzymes that catalyze transfer of gamma-phosphates, via a phosphohistidine intermediate, between nucleoside and dioxynucleoside tri- and diphosphates. The enzymes are products of the nm23 gene family, which includes NME4 (Milon et al., 1997 [PubMed 9099850]).[supplied by OMIM, May 2008] Transcript Variant: This variant (3) uses an alternate splice junction at the 5' end of the last exon compared to isoform 1. The resulting isoform (c) has a shorter and distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...