CIRBP (NM_001300815) Human Untagged Clone

CAT#: SC334118

CIRBP (untagged) - Human cold inducible RNA binding protein (CIRBP), transcript variant 4



  "NM_001300815" in other vectors (2)

CN¥ 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CIRBP Rabbit polyclonal Antibody
    • 100 ul

CN¥ 2,900.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CIRP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334118 representing NM_001300815.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCATCAGATGAAGGCAAACTTTTTGTTGGAGGGCTGAGTTTTGACACCAATGAGCAGTCGCTGGAG
CAGGTCTTCTCAAAGTACGGACAGATCTCTGAAGTGGTGGTTGTGAAAGACAGGGAGACCCAGAGATCT
CGGGGATTTGGGTTTGTCACCTTTGAGAACATTGACGACGCTAAGGATGCCATGATGGCCATGAATGGG
AAGTCTGTAGATGGACGGCAGATCCGAGTAGACCAGGCAGGCAAGTCGTCAGACAACCGATCCCGTGGG
TACCGTGGTGGCTCTGCCGGGGGCCGGGGCTTCTTCCGTGGGGGCCGAGGACGGGGCCGTGGGTTCTCT
AGAGGAGGAGGGGACCGAGGCTATGGGGGGAACCGGTTCGAGTCCAGGAGTGGGGGCTACGGAGGCTCC
AGAGACTACTATAGCAGCCGGAGTCAGAGTGGTGGCTACAGTGACCGGAGCTCGGGCGGGTCCTACAGA
GACAGTTATGACAGTTACGGTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001300815
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001300815.1
RefSeq Size 1170 bp
RefSeq ORF 507 bp
Locus ID 1153
UniProt ID Q14011
MW 18.2 kDa
Gene Summary Cold-inducible mRNA binding protein that plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. Acts as a translational activator. Seems to play an essential role in cold-induced suppression of cell proliferation. Binds specifically to the 3'-untranslated regions (3' UTRs) of stress-responsive transcripts RPA2 and TXN. Acts as a translational repressor (By similarity). Promotes assembly of stress granules (SGs), when overexpressed.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) contains an alternate 3' terminal exon, resulting in a novel 3' coding region and 3' UTR, compared to variant 5. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...