AP1S2 (NM_001272071) Human Untagged Clone

CAT#: SC334071

AP1S2 (untagged) - Human adaptor-related protein complex 1, sigma 2 subunit (AP1S2), transcript variant 1



  "NM_001272071" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to AP1S2 (adaptor-related protein complex 1, sigma 2 subunit)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DC22; MRX59; MRXS5; MRXS21; MRXSF; PGS; SIGMA1B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334071 representing NM_001272071.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGTTTATGTTGCTTTTTAGTCGTCAGGGAAAGCTTCGACTGCAAAAATGGTATGTCCCACTATCA
GACAAAGAGAAGAAAAAGATCACAAGAGAACTTGTTCAGACCGTTTTAGCACGGAAACCTAAAATGTGC
AGCTTCCTTGAGTGGCGAGATCTGAAGATTGTTTACAAAAGATATGCTAGTCTGTATTTTTGCTGTGCT
ATTGAGGATCAGGACAATGAACTAATTACCCTGGAAATAATTCATCGTTATGTGGAATTACTTGACAAG
TATTTCGGCAGTGTCTGTGAACTAGATATCATCTTTAATTTTGAGAAGGCTTATTTTATTTTGGATGAG
TTTCTTTTGGGAGGGGAAGTTCAGGAAACATCCAAGAAAAATGTCCTTAAAGCAATTGAGCAGGCTGAT
CTACTGCAGGAGGATGCGAAAGAAGCTGAAACCCCACGTAGTGTTCTTGAAGAAATTGGACTGACATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001272071
Insert Size 483 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001272071.1
RefSeq Size 2329 bp
RefSeq ORF 483 bp
Locus ID 8905
Protein Families Druggable Genome
Protein Pathways Lysosome
MW 18.9 kDa
Gene Summary Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as the small subunit of this complex and is a member of the adaptin protein family. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...